ID: 1019398491

View in Genome Browser
Species Human (GRCh38)
Location 7:836567-836589
Sequence GTCTGAAGGCAGTTTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019398487_1019398491 26 Left 1019398487 7:836518-836540 CCAGTTTGAAGGTCAGCTGGCTC 0: 1
1: 0
2: 4
3: 16
4: 152
Right 1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019398491 Original CRISPR GTCTGAAGGCAGTTTGTAGC TGG Intronic
903682090 1:25103819-25103841 GCCTGAAGGCAGTTTCTACTGGG - Intergenic
913160857 1:116145425-116145447 GTTTGAATGAAGTTTCTAGCTGG - Intergenic
915927188 1:160031768-160031790 GTACGAAGGCAGTTTGGAGCTGG - Exonic
916806230 1:168264265-168264287 GTCTGAAGGGAGTTCGTGGATGG + Intergenic
918602882 1:186384217-186384239 GTCAGAAGGCAGATTGGAGCTGG + Intronic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
1063718681 10:8556300-8556322 GTCTGAAGCCAGCTTGTATAGGG - Intergenic
1065797869 10:29323662-29323684 GTCTGACCGCAGTCTGGAGCAGG - Intergenic
1067286462 10:44911163-44911185 GGCTGGAGGCAGTCTGGAGCTGG - Intergenic
1068690595 10:59909894-59909916 GTCTGAAGACATTTTTTGGCTGG - Intergenic
1072423939 10:95313550-95313572 GTCTGAGGGTAGTTCATAGCTGG - Exonic
1074452327 10:113569217-113569239 GTCTGAAGGTAGTTTCTTGAGGG - Intronic
1076427142 10:130375195-130375217 GTCTGGAGGACTTTTGTAGCTGG - Intergenic
1078675844 11:13412993-13413015 GTCTCAAAGCAGTGTGTAGAAGG - Intronic
1079758030 11:24290626-24290648 GTCTGAAAGAAAGTTGTAGCAGG - Intergenic
1080835391 11:35935796-35935818 GTCGGAAGGTTGTTTGTAGGGGG + Intergenic
1084231827 11:67759118-67759140 GTCTGAATGCAGTTGTTGGCAGG - Intergenic
1085437752 11:76524090-76524112 TTCTGAAGGCAGTTGGTAGGAGG + Intronic
1085734713 11:79029446-79029468 GTCTGAGGGCAGTGTATGGCTGG + Intronic
1086230131 11:84558583-84558605 GATTTAAGGCAGTTTGTAGAGGG - Intronic
1090555862 11:127874718-127874740 ATCTGATGGCAGTTGGTAGAAGG - Intergenic
1091625658 12:2119045-2119067 GTCAGAAGGCCGTCTGTGGCAGG + Intronic
1094365576 12:29676603-29676625 GTTTGAAGGCAGAGTGTAGATGG - Intronic
1094608089 12:31966831-31966853 TTCTGAATAGAGTTTGTAGCTGG + Intronic
1098081444 12:66790243-66790265 GTCTGAAGGACCTATGTAGCTGG - Intronic
1098123087 12:67263704-67263726 GCCTGTAGTCAGTTTTTAGCTGG - Intergenic
1099622628 12:85024303-85024325 GACTGAAGACAGTCTCTAGCTGG + Intronic
1103740160 12:123085780-123085802 GTCTGGGGGCAGTTTGCAGAGGG - Intronic
1115372780 14:32637354-32637376 GCCAGAAGCCAGATTGTAGCAGG + Intronic
1117292367 14:54345823-54345845 GTCTGAAGGCTGTCTGCTGCAGG - Intergenic
1118192743 14:63594989-63595011 GTCTGCAGGCTCTTTGGAGCTGG - Intergenic
1119389782 14:74283344-74283366 GTCTGAAGGCAGAAAGCAGCAGG - Intergenic
1120477122 14:85002353-85002375 GCCTGAAGGCAATTTTAAGCAGG - Intergenic
1123916335 15:25032300-25032322 GACTGAAGGCATTTTTTGGCAGG - Intergenic
1125891215 15:43268600-43268622 GACAGAAGGCAGTCTGCAGCAGG - Intergenic
1130000032 15:80038298-80038320 GTCTGAAGGCTGTCTGCTGCAGG + Intergenic
1135192941 16:20369552-20369574 ATCTGAAGGCATTTTGTACCTGG + Exonic
1137616219 16:49848819-49848841 ATCTGGAGGCAGTTGGCAGCAGG + Intronic
1143909773 17:10238043-10238065 GTCTGGGGGCAGTTTTTATCAGG - Intergenic
1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG + Intronic
1146321794 17:31852728-31852750 CCCTGAAGGCAGTTTGGAACAGG - Intronic
1155444710 18:25899105-25899127 GTCTAAAGGCAGGTGGAAGCTGG + Intergenic
1157036244 18:43978489-43978511 GTCTGGAGTCAGTGTGTGGCGGG + Intergenic
1157160761 18:45312358-45312380 GTCTGAAGGTAGCCTGTAGAAGG - Intronic
1160328757 18:77973656-77973678 GACTGAAAGCAATTTGTGGCAGG + Intergenic
1163252760 19:16136048-16136070 GTGGGAAGGGAGTTTGTGGCTGG - Intronic
1165438854 19:35812471-35812493 GTCTATGGGCAGTTTGTGGCTGG - Exonic
925533614 2:4892126-4892148 GTCTATAGGCAATTTGTAGGCGG - Intergenic
926920808 2:17938089-17938111 TTCAGAGGGCAGTTAGTAGCTGG - Intronic
926939529 2:18120131-18120153 AACTGAAGGCAGTTGGAAGCTGG + Intronic
929944834 2:46362451-46362473 TTCTGAAGGCAGTTAGTGGCTGG + Intronic
930747390 2:54898688-54898710 ATCTGAAAGGTGTTTGTAGCTGG - Intronic
931300442 2:60973590-60973612 GGCTGAGGGCAGTTTGGTGCTGG + Intronic
939536165 2:143431956-143431978 ATCTGAAGTCAGTTGGAAGCTGG + Intronic
1169070960 20:2730081-2730103 GGCTGAGGGCACTTTGCAGCTGG + Intronic
1179360731 21:40705886-40705908 GTTAGAAAGCAGTTTGTGGCCGG + Intronic
1179615347 21:42579838-42579860 GACAGAAGGCACTTTGGAGCCGG - Intronic
1180910766 22:19448326-19448348 GTATGGAGGCGGTGTGTAGCAGG + Intergenic
949247853 3:1946560-1946582 GTCTGATGGTAGATGGTAGCTGG + Intergenic
949874960 3:8620513-8620535 GATTGAAGGCAGATTGTAGCAGG - Intronic
951331439 3:21373910-21373932 TTCTGAAGGCAATTTGGAGCAGG + Intergenic
952904900 3:38133304-38133326 GTCTGGAGCCAGATTGTAGGGGG + Intronic
953782341 3:45882323-45882345 GTCTGGAGGCAGTTAGTAGTTGG - Intronic
957266075 3:77967723-77967745 GTCAGAAGGCTGTGTGCAGCAGG - Intergenic
961394000 3:126573430-126573452 GACAGAGGGCAGTTTGGAGCAGG + Intronic
961673394 3:128550482-128550504 CACTGAAGCCAGTTTGAAGCTGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
968085699 3:195872998-195873020 TTCGGGAGGCAGGTTGTAGCTGG - Intronic
968153933 3:196362636-196362658 CTCTGATGGCAGCTTCTAGCTGG + Exonic
970764594 4:19532320-19532342 GACTGAGGGCAGATTGCAGCAGG - Intergenic
977290129 4:95156463-95156485 TTCTGAAGTCGGTTTGCAGCTGG + Exonic
985172742 4:187169685-187169707 GTCTGAAGGCAGTGTGGAGATGG + Intergenic
988581372 5:32471769-32471791 GTCTGAAGGCATCTTCTAGATGG + Intergenic
992182755 5:74214040-74214062 GGGTGAAGGCAATTTGTGGCAGG + Intergenic
992608994 5:78491195-78491217 GCCTCAAGGGACTTTGTAGCAGG + Intronic
994593918 5:101807086-101807108 CTCTGCAGGCAGGTTGTCGCAGG - Intergenic
994957833 5:106557218-106557240 GTCTTAAGCTAGTTTGTAGAAGG + Intergenic
995614370 5:113944413-113944435 GTCTGGAGGCAGCTAGGAGCAGG + Intergenic
997405497 5:133643472-133643494 GCCTGAAGGAAGTTTGGAGGAGG - Intergenic
1000107806 5:158077110-158077132 GTCTGAAGCCAGTTTGCATTTGG + Intergenic
1001232928 5:170005240-170005262 GTTTCCAGGCAGTTTGTAGCAGG + Intronic
1002327169 5:178417336-178417358 GTCTGAAGGCAGTAATCAGCAGG - Intronic
1006137776 6:31906388-31906410 GTCTGGAGGCAGGTTGAGGCTGG - Intronic
1008033029 6:46718305-46718327 TTTGGAAGGCAGTTTGTAGGAGG + Intronic
1010498905 6:76570030-76570052 GTCAGAAAGCAGTATGTATCTGG - Intergenic
1011871712 6:91902396-91902418 GGCTGAAAGCAGTCTGTACCTGG + Intergenic
1013989057 6:116232016-116232038 GTCTGAAACCAGGTTGTAGCAGG + Intronic
1014951013 6:127556339-127556361 GTCTGTGGGCAGTTGCTAGCTGG - Intronic
1015219432 6:130787505-130787527 GTCCTAAGGCAGAGTGTAGCTGG + Intergenic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1028527446 7:91801508-91801530 GGCTGAGGGCAGTTTGGTGCTGG - Intronic
1029104472 7:98164124-98164146 CTCTGAGTGCATTTTGTAGCTGG + Intronic
1030307281 7:108032091-108032113 GTTTAAAGGCAATTTGTGGCTGG + Intronic
1030570243 7:111213347-111213369 GCCTGAAGGCAGCTTGGTGCTGG + Intronic
1035416720 7:158695536-158695558 CACTGAAGGCTGTTTGGAGCTGG + Intronic
1037291971 8:17360729-17360751 CTCTGAAGGCAGTTTGGCACCGG - Intronic
1043871969 8:85442940-85442962 TTCTGAAGCCAGTCTGTATCAGG - Intronic
1044176924 8:89137426-89137448 GTCTGAAGGCTGTTGGGTGCAGG - Intergenic
1053275833 9:36782679-36782701 CTCTGGAGGCAGCTGGTAGCAGG - Intergenic
1057459482 9:95246758-95246780 GCCTGAAGGCACTTTGTGTCAGG - Intronic
1058079732 9:100689228-100689250 TTCTGAAGTGAGTTTGTAGCAGG - Intergenic
1060853262 9:126895005-126895027 TTTAGAAGGCAGTTTGCAGCCGG - Intergenic
1192196590 X:69032872-69032894 CTCTGGAGGCAGCTTGTGGCCGG + Intergenic
1194365284 X:93006691-93006713 GTATCAAGGCAGTATGGAGCAGG + Intergenic
1195128113 X:101828997-101829019 ATCTGAAGGCAGTTTGCTGGCGG + Intergenic
1195433133 X:104811875-104811897 GACTGAACGCTGTTTGTGGCAGG + Intronic
1195909115 X:109871588-109871610 TTCAGAAGGCAGTATATAGCTGG + Intergenic
1200673504 Y:6122949-6122971 GTATCAAGGCAGTATGGAGCAGG + Intergenic
1200876906 Y:8166104-8166126 GTCTGAAGTCAATATGTTGCAGG + Intergenic