ID: 1019399515

View in Genome Browser
Species Human (GRCh38)
Location 7:844237-844259
Sequence GCTGCAGGTGAGAGAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 364}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019399515_1019399528 19 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399528 7:844279-844301 CGGCCGGGCCGGGTGCTGCCTGG No data
1019399515_1019399525 9 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399525 7:844269-844291 CTGGGACCCTCGGCCGGGCCGGG No data
1019399515_1019399523 4 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399523 7:844264-844286 AGAGGCTGGGACCCTCGGCCGGG No data
1019399515_1019399518 -10 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399518 7:844250-844272 CACCTGCAGCAGGAAGAGGCTGG No data
1019399515_1019399524 8 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399524 7:844268-844290 GCTGGGACCCTCGGCCGGGCCGG 0: 1
1: 0
2: 3
3: 31
4: 285
1019399515_1019399519 -9 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399519 7:844251-844273 ACCTGCAGCAGGAAGAGGCTGGG 0: 1
1: 0
2: 6
3: 83
4: 723
1019399515_1019399522 3 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399522 7:844263-844285 AAGAGGCTGGGACCCTCGGCCGG 0: 1
1: 0
2: 4
3: 31
4: 202
1019399515_1019399521 -1 Left 1019399515 7:844237-844259 CCAGGATCTCTCTCACCTGCAGC 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1019399521 7:844259-844281 CAGGAAGAGGCTGGGACCCTCGG 0: 1
1: 0
2: 4
3: 79
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019399515 Original CRISPR GCTGCAGGTGAGAGAGATCC TGG (reversed) Intronic
900771756 1:4550690-4550712 GCTGCAGGGGAGAAAGAACATGG + Intergenic
901511638 1:9720744-9720766 GCTGCAGCTGCGGGAAATCCTGG + Exonic
902106570 1:14041547-14041569 GCTCCAGGAGAGAGAAATCAAGG - Intergenic
902517451 1:16996983-16997005 GCTGGGCTTGAGAGAGATCCCGG - Intronic
902683178 1:18058246-18058268 GCTACAGGAGACAGAGACCCGGG - Intergenic
903060804 1:20667281-20667303 ACTGCACGTGTGAGGGATCCAGG + Intronic
903849610 1:26297934-26297956 GCTCCAGGTGGGAGAGGGCCAGG - Intronic
904082666 1:27882062-27882084 GCTGCTGCTGAGCGAGGTCCTGG + Exonic
904562366 1:31407246-31407268 GCCTCAGGTGACAGAGTTCCTGG + Intergenic
904827291 1:33281779-33281801 GCTGGAGGTGGGAGAGCTGCCGG - Exonic
907287341 1:53390310-53390332 TCTGCGGGTCAGAGAGCTCCAGG + Intergenic
907861282 1:58356094-58356116 GGTGGAGATGAGAGAGAACCAGG + Intronic
907992221 1:59594146-59594168 GGTGCAGGTGGAAGAAATCCAGG - Intronic
913150119 1:116033443-116033465 GCTGGTGGTGAGAGAGAACGGGG - Intronic
914350773 1:146837937-146837959 ACTGCACGTGTGAGGGATCCAGG + Intergenic
914446721 1:147756988-147757010 CCTCCAGGAGAGAGAGATCTGGG + Exonic
914911539 1:151791209-151791231 GCGGCAGGAGAGTGAGACCCGGG + Exonic
916749988 1:167714753-167714775 GCTTCGGGTGCGAGAGGTCCCGG + Intergenic
917262728 1:173187577-173187599 GCTGCAGGTGGAAGAGCTCAAGG + Intronic
919006638 1:191908050-191908072 GCAGCAGGAGAGAGAGAGCAAGG + Intergenic
919350900 1:196452761-196452783 GCTGATGGTGTGAGAGACCCAGG + Intronic
919755908 1:201066213-201066235 GTTGAAGGTGAGAGAGGGCCCGG - Exonic
920544974 1:206808869-206808891 GCTGCAGGGGCTAGAGATGCTGG + Intronic
921377925 1:214493135-214493157 GCTGCAGGGCAGAGGGGTCCTGG + Intronic
923292052 1:232555377-232555399 GCTGGAGGTGATAAAGATCAGGG - Intronic
923687079 1:236160821-236160843 ACTGCAGGGGAGAGAGGCCCCGG - Intronic
923966080 1:239140608-239140630 GCTGCAAGTGAGTGAGTTACTGG - Intergenic
924403875 1:243720999-243721021 GGAGAAGATGAGAGAGATCCAGG - Intronic
924798237 1:247308514-247308536 GCTGCAGGTGCCAGAGTTCCAGG - Exonic
1064151348 10:12868312-12868334 GGTGAAGGTGAGAGAGAGACTGG - Intergenic
1066450801 10:35528133-35528155 GCTACAGGAGAGACAGAACCTGG - Intronic
1066987030 10:42476428-42476450 CCAGAAGGTGACAGAGATCCTGG - Intergenic
1069504947 10:68989252-68989274 GGCGCAGGTGAGAGCGAGCCCGG + Exonic
1069552744 10:69375877-69375899 GCTGCAGGGGAGAGGCAGCCAGG - Intronic
1069589907 10:69635226-69635248 GGTGCAGGTGAGAGACCTGCTGG - Intergenic
1070752472 10:78972434-78972456 GCTGCAGGAGTGAGCAATCCTGG + Intergenic
1070843973 10:79507110-79507132 GCTGCAGGTGGATGAGGTCCCGG + Intergenic
1070843987 10:79507179-79507201 GCTGCAGGTGGATGAGGTCCCGG + Intergenic
1070844075 10:79507629-79507651 GCTGCAGGTAGATGAGATCCGGG + Intergenic
1070929728 10:80252689-80252711 GCAGCAGGTGATTGAGGTCCTGG - Intergenic
1071516735 10:86302606-86302628 TCTGGAGGTGAGTGTGATCCAGG - Intronic
1072012761 10:91318166-91318188 GCTTTAGATGAGAGAAATCCTGG + Intergenic
1073830166 10:107374785-107374807 GCTAAAGATGAGAGAGATCATGG - Intergenic
1074910560 10:117904893-117904915 CCTGCAGATGATAGAGAACCAGG + Intergenic
1075207024 10:120457010-120457032 GCTCCTGGGGAGAGGGATCCGGG + Exonic
1075572969 10:123558747-123558769 GCTGCAGGTGGGATTGAGCCAGG + Intergenic
1075811233 10:125226616-125226638 GCTGCTGCTGAGAGAGGTCAAGG - Intergenic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1076807729 10:132867339-132867361 GCTGCGGGTCAGAGGGATTCTGG + Intronic
1077028174 11:450846-450868 GCTGTAGGTGGGGGAGACCCTGG + Intronic
1077163096 11:1122472-1122494 CCTGGAGCTGGGAGAGATCCTGG + Intergenic
1077330025 11:1980110-1980132 GCTGGAGGTGGGAGCGATTCTGG + Intronic
1077361222 11:2140941-2140963 GCTGAAGGTGAGCGAGACCCCGG + Exonic
1077487170 11:2844340-2844362 GCTGCTGGTGACAGAGGCCCCGG - Intronic
1077574952 11:3375907-3375929 GGTGCTGGTGAGAGAGTTCCTGG + Intronic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG + Intergenic
1081507759 11:43735863-43735885 GTGGCAGGAGAGAGAGATCGAGG + Intronic
1081561505 11:44221294-44221316 GCTGCAGATAGGAAAGATCCTGG - Intronic
1082104964 11:48211548-48211570 GCAGTAAGTGAGAGAGAGCCTGG - Intergenic
1083595815 11:63917811-63917833 GCTGCAGGGGAGAGAGGAGCTGG + Intergenic
1084029304 11:66471809-66471831 ACTGCAGGTCAGAGAGAAACTGG - Intronic
1084460504 11:69294246-69294268 GCTTCAGGTGAGGGAGACCCTGG - Exonic
1084936527 11:72589975-72589997 GCTGCAGCTGAGAGAGGGACAGG + Exonic
1084936592 11:72590209-72590231 GCTGCAGGGAAGAGGCATCCAGG + Exonic
1085455066 11:76660957-76660979 GATGCAGGTGAGGGAATTCCTGG + Exonic
1087131617 11:94673756-94673778 TCTGCAGGTGTGAGAAACCCTGG + Intergenic
1087836457 11:102880003-102880025 GCTGCAGGGAAGTGAGATGCAGG + Intergenic
1088093988 11:106077296-106077318 GTTGCAGGTGGGTGAGCTCCGGG - Exonic
1088965925 11:114721088-114721110 GCTGAAGGTGAGAGAACTCCTGG - Intergenic
1089453770 11:118613890-118613912 GGTGCAGGTGAGTGGGATCAGGG + Exonic
1090949143 11:131457417-131457439 GCAGCAGGTCAGAGAGAGGCTGG + Intronic
1091171026 11:133519901-133519923 GCTGCATGTGAGACAGACCTGGG + Intronic
1202813002 11_KI270721v1_random:35289-35311 GCTGGAGGTGGGAGCGATTCTGG + Intergenic
1091447558 12:552753-552775 GCTGGAGGAGAGTGAGAGCCCGG + Intronic
1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG + Intergenic
1091978510 12:4846665-4846687 GATGAAGGTGAGAGAGAGCCTGG - Intronic
1092050286 12:5464637-5464659 GCTGAAGGTGAGTGTGATGCAGG + Intronic
1092088619 12:5786037-5786059 GCTGGGGGTGAGAGAAATCCAGG + Intronic
1092119484 12:6034071-6034093 CCAGCAGATGAGAGCGATCCAGG - Intronic
1092903936 12:13085216-13085238 GCAGCAGGTGAAGGAGAGCCAGG + Exonic
1093168035 12:15828321-15828343 TCTGAAGGTGATAGAGATTCAGG + Intronic
1094049425 12:26203004-26203026 GCTGCAGGAGAGAGAGCACTGGG + Intronic
1094061938 12:26323570-26323592 TCTGCAGGTGAGACACATTCTGG - Intergenic
1097291961 12:57924693-57924715 GCAGCAGGAGAGAGAGAGCGAGG + Intergenic
1099233990 12:80060326-80060348 GCTGCAGTGGAGAGAGCTCATGG + Intergenic
1100270253 12:93017804-93017826 ACTTCAGGAGATAGAGATCCTGG + Intergenic
1102069882 12:110009667-110009689 TCTTCAGATGAGAGAGATGCAGG + Intronic
1102538590 12:113601234-113601256 TCTGGAAGTCAGAGAGATCCAGG - Intergenic
1104958570 12:132477517-132477539 GAGGCAGGGGAGAGAGATGCAGG - Intergenic
1104972589 12:132538666-132538688 GCTGCAGGTGAGTGAGGCTCTGG - Intronic
1105345105 13:19564598-19564620 GCTGCAGGTCAGACAGGGCCTGG - Intergenic
1107384630 13:39894576-39894598 GCTGCAGGTGAGAAAGGTGGGGG + Intergenic
1107601864 13:42022124-42022146 GCTGAAAGTGAGAGAGATGGTGG + Intergenic
1108090155 13:46841069-46841091 GTGGCAGGTGAGAGAGAGCGTGG - Intronic
1108825078 13:54403549-54403571 GCAGCAGGGGAGAAAGATGCAGG - Intergenic
1109073429 13:57800725-57800747 GCTGAAGGTAATAGAGAACCTGG - Intergenic
1111300548 13:86343704-86343726 GCTGAAGGCCAGAGAGTTCCTGG - Intergenic
1112130252 13:96515694-96515716 GCAGCAGGTGAGAGAGAGCATGG - Intronic
1112227186 13:97551279-97551301 GCAGCAGGAGAGAGAGAGCTGGG - Intergenic
1112426222 13:99303896-99303918 GCAGCAGGTGAGGGAGAACACGG - Intronic
1113325320 13:109275995-109276017 GCTGCAGGTGTAAGGGATGCAGG - Intergenic
1113755675 13:112809005-112809027 AATGCAGGTGAGAGACACCCAGG - Intronic
1113904035 13:113811219-113811241 GGGGCCGGTGAGAGAGGTCCTGG + Intronic
1113904085 13:113811351-113811373 GGGGCCGGTGAGAGAGGTCCTGG + Intronic
1114182651 14:20378991-20379013 GCTGCAGGTCCCAGAGCTCCAGG + Exonic
1114268044 14:21084135-21084157 GCTCCAGGTCAGAGGGCTCCAGG + Intronic
1114719753 14:24868675-24868697 GCTGCAGGTCAAAGAGGTCATGG + Intronic
1116646395 14:47534510-47534532 GCAGCAAGTGAGAGAGAGCCAGG + Intronic
1116753053 14:48910798-48910820 GTTGGAGATGAGAGACATCCTGG - Intergenic
1117457336 14:55911685-55911707 GTTCCAGGTGACAGAGAGCCGGG + Intergenic
1118709841 14:68510134-68510156 GCAGTAGGGGAGACAGATCCTGG - Intronic
1120073154 14:80125562-80125584 ATAGCAGGTGAGAGAGAACCTGG + Intergenic
1120847591 14:89139584-89139606 CCTGCAGGTGAGAGAGAGCCTGG + Intronic
1121426519 14:93856179-93856201 CCTGCAGGTGAGAAAGGGCCTGG + Intergenic
1121495515 14:94389270-94389292 GATGCAGGTGAAACAGTTCCTGG - Intronic
1121825385 14:97006278-97006300 GCTGCAGGAGGGGGAGATCGAGG - Intergenic
1124623830 15:31297006-31297028 GCTGCAAGTGACAAAGACCCAGG + Intergenic
1126669649 15:51104547-51104569 GCTGCAGCAGACAGAGAGCCAGG - Intronic
1126973661 15:54149106-54149128 GCAGCAGGAGACAGAGAGCCAGG - Intronic
1128613012 15:69088752-69088774 TCTGCAGGTGACAGTGATTCAGG - Intergenic
1129033802 15:72637811-72637833 ACTTCAGGTGAGAGAGAGCATGG + Intergenic
1129216079 15:74099405-74099427 ACTTCAGGTGAGAGAGAGCATGG - Intergenic
1129726050 15:77902284-77902306 CCTGCAGGTGAGAGTATTCCTGG + Intergenic
1130202204 15:81842530-81842552 GCAGCAAGTGGGAGAGCTCCAGG - Intergenic
1130484945 15:84393685-84393707 GCTGCAGGTGACACAGGTACTGG - Intergenic
1130792349 15:87168885-87168907 CCTGCAGGTCAGAGAGGTCATGG + Intergenic
1131581967 15:93652164-93652186 GCTGCAGGTGAGAGGGAAGAGGG - Intergenic
1131999760 15:98166550-98166572 GCTGTAGTTGAGAGAGAGCAAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133060615 16:3172076-3172098 GCTTCGGGTGCGAGAGGTCCCGG + Intergenic
1134241518 16:12510331-12510353 GCAGCAGATGAGAGAGAGTCAGG + Intronic
1134692079 16:16197663-16197685 GCAGAAGGTGGGAGAGATGCAGG + Intronic
1134794853 16:17025692-17025714 GCTGCAGGAGAGAGAGAGCAGGG - Intergenic
1134851567 16:17483130-17483152 TGTGCAGGTGAGAGAGATGCTGG - Intergenic
1135680956 16:24456192-24456214 GCAGCAGGAGAGAGAGAGCACGG - Intergenic
1136482719 16:30552677-30552699 GCTGAAGGAGAGAGAGACCTTGG + Intronic
1136554715 16:31001178-31001200 GCTCCAGGTGGAAGAGATCCGGG - Exonic
1136653607 16:31695165-31695187 GCAGCAGGAGAGAGAGAGACAGG + Intergenic
1136657472 16:31718808-31718830 GGTGCTGGTGAGGGAGTTCCTGG - Intronic
1137332404 16:47511966-47511988 GCTGCACATGCGAGGGATCCAGG - Intronic
1137797469 16:51234044-51234066 GCTTCAGGTGCAAGGGATCCTGG + Intergenic
1138292870 16:55862821-55862843 CCTGAAGGACAGAGAGATCCTGG + Intronic
1139216131 16:65125273-65125295 GCTGCAGGTCACAGATATTCTGG - Intronic
1139636530 16:68261523-68261545 GGTACAGATGAGAGAGATCAAGG + Intergenic
1140378601 16:74465726-74465748 GCTGCAGGAGACAGAGATGATGG - Exonic
1140894251 16:79311142-79311164 GCTGCGGGAGGGAGAGAGCCTGG - Intergenic
1141042529 16:80684389-80684411 GCTCTAGGTGAGAGAGATGAAGG + Intronic
1141124911 16:81394410-81394432 GCAGCAGGAGAGAGAGAACGGGG + Intergenic
1141566698 16:84907204-84907226 GCTGCGGGTATGAGAGACCCCGG + Exonic
1143644700 17:8222854-8222876 GCTTCGGGTGCGAGAGGTCCCGG - Intergenic
1146308138 17:31746314-31746336 GCAGCAGCTGAGAGACATCTCGG + Intergenic
1146638365 17:34522357-34522379 GCAGGAAGTGAGAGAGATCCTGG - Intergenic
1146708051 17:35016469-35016491 GCGGCAGCTGAAAGAGATCTTGG - Exonic
1147385121 17:40076675-40076697 GTTGCAGGGGAGAGAGATAAGGG - Intronic
1147503362 17:40987805-40987827 GGGGCAGGTGAGAGAGAGCGTGG - Intergenic
1149665628 17:58363169-58363191 CCTGGAGCTGCGAGAGATCCTGG - Intronic
1150350445 17:64440206-64440228 GCGGCAGGAGAGAGAGAGGCAGG + Intergenic
1150480420 17:65504665-65504687 GGTGCAAGTGAGAGGGATGCGGG - Intergenic
1152430122 17:80244191-80244213 GCCCCAGGTGAGACAGATGCTGG + Intronic
1152446529 17:80348025-80348047 GCTGCAGGTCATAGAGAGGCAGG + Exonic
1153545100 18:6196907-6196929 GTTGCAAGTGAGAGAAAGCCGGG - Intronic
1155241906 18:23871890-23871912 GCTGAGGGTTAGAGAAATCCAGG + Intronic
1156499825 18:37550665-37550687 GCTGCAGCAGAGAGGGACCCAGG - Intronic
1156863401 18:41863879-41863901 GCTGCAGATGAGTGAAACCCAGG - Intergenic
1160262709 18:77310018-77310040 GCTGAAGGTCTGAGAGCTCCTGG - Intergenic
1160860056 19:1233913-1233935 GCTGCAGGTGAGGGAGGGCAGGG + Intronic
1161062452 19:2222026-2222048 GCTCCAGGTGTGAGAGAGGCCGG - Exonic
1162067901 19:8136992-8137014 GCTTCAGGTTGGAGGGATCCAGG - Intronic
1162191463 19:8950311-8950333 GTTGCAGCTGAGTGAGTTCCTGG + Exonic
1162926618 19:13933412-13933434 GCTGGTTGTGGGAGAGATCCAGG + Exonic
1164505869 19:28860788-28860810 GGTGCAGGGGAGAGTGAGCCAGG + Intergenic
1164930607 19:32172979-32173001 GGGGCAGGTGGGAGAGAACCTGG - Intergenic
1165715665 19:38044297-38044319 CCTGAAGTTGAGAGAGGTCCAGG + Intronic
1165950651 19:39472487-39472509 GCTGGAGGTGAGAGGGGTTCAGG + Exonic
1166334340 19:42096195-42096217 GCTGCGGGTGCGAGAGGTGCGGG + Exonic
1166998842 19:46733052-46733074 GCTGCTGGTGAAACAGATCGAGG - Exonic
1167115424 19:47486793-47486815 GCTGCAGGGGAGAGAGGAGCAGG + Intergenic
1167170945 19:47831503-47831525 ACTGCACGTGCGAGAGATCTAGG + Intronic
1167281008 19:48568576-48568598 GCTCCAAGTGAGGGAGAGCCTGG + Intronic
1168403477 19:56099048-56099070 CCTGCAGGCGGGACAGATCCAGG - Intronic
1168715634 19:58525549-58525571 GCTGCAGCTTAGAGAGAGGCTGG + Intronic
925582285 2:5423258-5423280 GCAGCAGGAGAGAGAGAGCAAGG - Intergenic
925806238 2:7651860-7651882 GCAGAAGGTGAAAGAGATGCAGG + Intergenic
925997774 2:9306262-9306284 GCTGTAGGGGATAGAGATACCGG + Intronic
926023467 2:9517635-9517657 GCTGCAGGTCAGAGGGGTCCAGG + Intronic
927817599 2:26233049-26233071 ACTGCACATGAGAGGGATCCAGG - Intronic
928495093 2:31823283-31823305 GCAGCTGGAGACAGAGATCCAGG - Intergenic
929346208 2:40887664-40887686 GCCGCACATGAGAGAGATCTAGG + Intergenic
929412002 2:41707442-41707464 GCAGCAGGAGGCAGAGATCCAGG - Intergenic
930812697 2:55559616-55559638 GCAGCAGGAGAGAGAGAGCAAGG - Intronic
931190684 2:59997122-59997144 GCTGCAGGTGAGGGTGTTGCTGG - Intergenic
931465856 2:62486249-62486271 GCTGGAGGTGAGGGAGAACTGGG + Intergenic
932463045 2:71895737-71895759 GGTGCGGCTGAGAGAGCTCCTGG + Intergenic
935162742 2:100543335-100543357 GCTGCAGGTGAGATGGAGCAAGG - Intergenic
935323481 2:101911483-101911505 CCTGCAGGTGATACAGATACTGG + Intergenic
935785262 2:106543170-106543192 GCTGCAGGTAAGGCAGTTCCCGG - Intergenic
936269883 2:111041498-111041520 TCTGCAGGTGGGACAGAGCCGGG + Intronic
937290119 2:120776909-120776931 TTTGCAGGTGGGAGAGGTCCTGG - Intronic
937926764 2:127173871-127173893 GCTCCAGGTGAGAGATAAACAGG + Intergenic
939054242 2:137344102-137344124 GCTGCACATGAGAGGGATCTAGG + Intronic
939669390 2:144991452-144991474 GTGGCAGGTGAGAAAGAGCCCGG + Intergenic
940119116 2:150243109-150243131 GCTGCAGGTGAGAGAGAAGTAGG - Intergenic
940769987 2:157829373-157829395 ACTGCTGGTGGGAGAGGTCCTGG - Intronic
940986616 2:160057813-160057835 TCTGCAGGTGAGTGAGCTCCAGG - Intronic
942043162 2:172084391-172084413 ACTGGAGGTGAGGAAGATCCTGG + Intergenic
944193011 2:197023440-197023462 TCTGCAGCTGACAGAGACCCAGG - Intronic
946411319 2:219516680-219516702 GCAGCGGGTGAGTGAGAACCTGG - Intronic
946635547 2:221721333-221721355 TCTCCATGTGAGTGAGATCCTGG - Intergenic
946666990 2:222060768-222060790 GCTGCAGGAGAGAGACACCCCGG + Intergenic
947354678 2:229279793-229279815 GCTGCAGGAGGGAGAGCACCAGG + Intergenic
947664404 2:231894641-231894663 ACTGCATGTCAGAGAGATCTGGG - Intergenic
947715155 2:232335581-232335603 GCAGCAGGTGAGAGTGACCAAGG - Intronic
947720690 2:232367806-232367828 GCAGCAGGTGAGAGTGACCAAGG - Intergenic
947734230 2:232446532-232446554 GCAGCAGGTGAGAGTGACCAAGG - Intergenic
947813515 2:233020806-233020828 GGAGCAGGAGAGAAAGATCCTGG - Intergenic
947961099 2:234238137-234238159 GCTGCAGAAGAGAAAGACCCTGG - Intergenic
948110237 2:235449013-235449035 GTTGAAGGTGAGAGACAGCCAGG + Intergenic
948292533 2:236836675-236836697 GCTGCAGGGGAGAGAAAGCAGGG + Intergenic
1168772188 20:422214-422236 GCTGCTGGAGAGGGAGATCAAGG + Exonic
1169214473 20:3785409-3785431 GCTGCAGGCCTGAGGGATCCTGG + Exonic
1170079304 20:12454080-12454102 GATGCAGAGAAGAGAGATCCAGG - Intergenic
1170596897 20:17812628-17812650 CCTGGAGGTGAGAGAGGTGCTGG - Intergenic
1170858232 20:20077448-20077470 GCGACAGGTCACAGAGATCCAGG + Intronic
1170894016 20:20398222-20398244 GCTGCAGAGGAGTGAGATCAAGG - Intronic
1171240113 20:23560561-23560583 ACTGCACGTGAGAGGGATCTAGG + Intergenic
1173253970 20:41380258-41380280 GCCTCAGAGGAGAGAGATCCAGG - Intergenic
1173671535 20:44802492-44802514 GATGTAGGTGTGAGAGACCCTGG - Intronic
1174390661 20:50216614-50216636 GCTGCAGGTCTGAGTGCTCCTGG + Intergenic
1174967951 20:55240433-55240455 GTGGCAGGAGAGAGAGAGCCGGG - Intergenic
1175310628 20:58009349-58009371 GCTCCATGTGAGAGAGATTTGGG - Intergenic
1175349151 20:58306349-58306371 GCTACAGGTGTGAGAGAGCCAGG + Intergenic
1175834452 20:61984729-61984751 TCTGCAGCTGACAGAGTTCCCGG - Intronic
1175995898 20:62812214-62812236 GCTGCGCCTGCGAGAGATCCGGG - Exonic
1176975118 21:15312249-15312271 GCAGCAGGAGAGAGAGAGCGTGG - Intergenic
1177709346 21:24751583-24751605 CCTGAAGGTGAGGGAGGTCCAGG - Intergenic
1177714130 21:24817445-24817467 GCTGCACATGTGAGGGATCCAGG + Intergenic
1178065235 21:28897332-28897354 GCTGCAGTTGAGAGAGTTAATGG + Intergenic
1178804945 21:35831472-35831494 GCTTCAGGAGGGAGAGCTCCTGG - Intronic
1179415526 21:41195356-41195378 GCTGCAGATGGGAGATGTCCAGG + Intronic
1179442154 21:41402831-41402853 GCTGCACGTGCGAGGGATCTAGG - Intronic
1180995889 22:19964982-19965004 GCTGCAGGTGAGCGAGCACCAGG - Intronic
1181507536 22:23370191-23370213 CCTGAAGGACAGAGAGATCCTGG + Intergenic
1182041020 22:27239221-27239243 GCTGCAGCTGACACAGAGCCTGG - Intergenic
1182279236 22:29208516-29208538 GCTGCAGGGGCGAGAGATCTGGG - Intronic
1182295706 22:29310432-29310454 GCCTCAGGTGAGGGAGATTCTGG + Exonic
1183309211 22:37100394-37100416 GCTCCAGGGGAGAGATGTCCAGG + Intronic
1183525079 22:38317769-38317791 CCTGGAGAGGAGAGAGATCCTGG - Intronic
1183969926 22:41469176-41469198 GCTGCAGGTGAGCGAGCTCAGGG + Exonic
1184589082 22:45469111-45469133 GCTGCAGCAGAGAAGGATCCAGG + Intergenic
1184685916 22:46096295-46096317 GCTGCAGGTGATAGATAGCAAGG - Intronic
1185346744 22:50313724-50313746 CCTGCAGGGGAGAGAGGGCCAGG + Exonic
950083345 3:10239262-10239284 GATGGAGGTGAGAGAGATTTTGG - Intronic
951973583 3:28476847-28476869 ACTGCACGTGGGAGAGATCTAGG - Intronic
952826695 3:37530443-37530465 GCTGCAGCTAAGAGAAAACCTGG + Intronic
953907963 3:46877837-46877859 GCTGCAGGTGAGTGGGGGCCAGG + Intronic
954344329 3:49983916-49983938 GATCCTGGTGAGAGAGGTCCTGG + Intronic
954447194 3:50553158-50553180 GCCACAGGTGAGGGACATCCCGG + Intergenic
954711196 3:52505879-52505901 CCTGCAGTTTAGAGAGACCCTGG - Exonic
954714465 3:52520256-52520278 GCTGCAGGAGAAAGAGATGGGGG - Exonic
955490738 3:59479628-59479650 GCTGCAGGTGGGAGAGCGCCCGG - Intergenic
955742518 3:62107044-62107066 CTTACAGGTGAGAGAGATCCTGG - Intronic
956493299 3:69797196-69797218 GCTGAAGGTCAGAGTGATACAGG + Intronic
956577880 3:70775351-70775373 GCAGCAGATGAGGGAGCTCCAGG + Intergenic
957430811 3:80103944-80103966 GCTGCAGCTGAGAAGGGTCCAGG - Intergenic
957901482 3:86499568-86499590 GCTGCAGGAGAGAGAGAGCGAGG + Intergenic
961107749 3:124256674-124256696 GCTCCAGGTCTGATAGATCCAGG - Intronic
961511450 3:127406330-127406352 GCTGCAGCTCAGAGAGGTACAGG + Intergenic
962204601 3:133424520-133424542 GCTGGAGGTGGGAGAGATTAGGG - Intronic
962431975 3:135328280-135328302 GCTGCAGGTGAGAGAGCTGAGGG + Intergenic
963515186 3:146300513-146300535 GCTCCAGGTGAGGGAGAACATGG + Intergenic
964722376 3:159780149-159780171 GCTGCAGGTAGAAGAGCTCCCGG + Intronic
965299429 3:166991066-166991088 GTTACATGTGAAAGAGATCCTGG - Intergenic
968768722 4:2489400-2489422 GACACAGGTGAGAGGGATCCAGG - Intronic
969040893 4:4295281-4295303 GCAGCAGGGGAGAGAGAACCGGG + Intronic
970116459 4:12702162-12702184 GCTGCGGGACACAGAGATCCTGG + Intergenic
970639074 4:18043619-18043641 ATTGCTGGTGAGAGAAATCCAGG - Intergenic
971876732 4:32318206-32318228 GCAGCAGGGCAGACAGATCCAGG + Intergenic
972178143 4:36432937-36432959 GCTGAAGGCCAGAGAGCTCCTGG + Intergenic
973073500 4:45894813-45894835 GCAGCAGGTGAGATAGAGCAGGG - Intergenic
973720317 4:53717322-53717344 GCTGCAAGTGAGAGAGAGAGTGG + Intronic
975217321 4:71770433-71770455 GCTGCATATGAGAGATCTCCAGG + Intronic
976206715 4:82629286-82629308 GCTGCTGGTGAGTGAGAATCAGG + Intergenic
979201553 4:117985283-117985305 ACTGCACATGAGAGGGATCCAGG + Intergenic
981063439 4:140453717-140453739 GCAGCAGGAGAGAGAAAGCCAGG - Intronic
983287160 4:165754403-165754425 GCTGCAGGTGATAGATATGGTGG - Intergenic
983699810 4:170578589-170578611 GCGGCAGGTGAGGGAGAACATGG + Intergenic
985046720 4:185948196-185948218 GCTGCAGATTGGAGAGATTCAGG - Intronic
986487674 5:8255600-8255622 GCTGCAGAAAAGAGAGAGCCTGG + Intergenic
986740876 5:10704106-10704128 GCTCCAGGTAAAAGAGATCAGGG - Intronic
986864780 5:11973486-11973508 GCTGCTGATGAGAGAGCTGCTGG - Intergenic
987169473 5:15239436-15239458 GCAGCAGGAGAGAGAGAGCAGGG - Intergenic
987201586 5:15583117-15583139 GTGGCAGGTGAGAGAGAGCAGGG + Intronic
987351356 5:17024992-17025014 GGAGCTGGTGAGAGAGAACCTGG + Intergenic
987424769 5:17760262-17760284 TCTGCAGGGGAGAGAGAACATGG + Intergenic
987915313 5:24205222-24205244 GCTGAAGGCCAGAGAGCTCCTGG - Intergenic
988310450 5:29549665-29549687 GCAGCAGGGGAGAGAGAGCAGGG + Intergenic
991965103 5:72083020-72083042 TCTGAAGGTGAGAGAGAACATGG + Intergenic
992125284 5:73633375-73633397 GCTGCAGGTCAGAGAGACTTGGG + Intronic
992499887 5:77331475-77331497 CCTGCAACTGAGAGAGATGCTGG - Intronic
993517329 5:88854563-88854585 AATTCAGGTGAGAGAGATCTAGG - Intronic
993632099 5:90299074-90299096 GCTGCTGGTGAGAGAGGTAGGGG + Intergenic
994936199 5:106256171-106256193 GCAGAAGGTGAAAGAGATGCAGG - Intergenic
995062283 5:107823736-107823758 GCAGCAGGAGAGAGAGAACAAGG - Intergenic
995748375 5:115427871-115427893 GCAGCAGGAGAGAGAGAGCAAGG - Intergenic
995997729 5:118321835-118321857 GTGGCAAGTGAGAGAGATCAGGG + Intergenic
997206849 5:132055211-132055233 GCTGCAGGTCAGAGCTGTCCAGG - Intergenic
997952288 5:138252160-138252182 GCTGGAGCTGGGACAGATCCCGG + Intergenic
998404902 5:141868796-141868818 GCTGCAGGTGGCAGAGGACCAGG - Exonic
998498435 5:142611290-142611312 TCTGCAGGTGAGAGGAGTCCTGG - Intronic
1000695122 5:164371439-164371461 GCAGCAGGAGAGAGAGAGCAGGG + Intergenic
1001429192 5:171646136-171646158 GGAGCAGGTGACAAAGATCCAGG + Intergenic
1001733048 5:173974110-173974132 GCTGCAGGTGAAGGAGATGCTGG + Intronic
1002949677 6:1797178-1797200 ACTGCACGTGCGAGGGATCCAGG + Intronic
1003045319 6:2728468-2728490 GCTGCGGGACACAGAGATCCTGG - Intronic
1003627194 6:7752698-7752720 TCTGGAGGTGAGAAAGATACAGG + Intronic
1003644668 6:7904865-7904887 GGAGCAGGGGAGAGAGGTCCTGG - Intronic
1004917809 6:20348136-20348158 GCAGCATGTGGGATAGATCCTGG + Intergenic
1005565688 6:27091770-27091792 GCTTCGGGTGTGAGAGGTCCCGG + Intergenic
1006675577 6:35760360-35760382 GCGGCAGGAGAGAGAGAGCGAGG + Intergenic
1007275577 6:40671126-40671148 GCTGCTGATGAGAGAGCTGCTGG - Intergenic
1012994159 6:105957086-105957108 GCTGCAGGTGAGGGAGTGCTGGG + Intergenic
1015001128 6:128217137-128217159 GGCTCAGGTGAGAGAGATGCTGG + Intronic
1019399515 7:844237-844259 GCTGCAGGTGAGAGAGATCCTGG - Intronic
1019410117 7:903061-903083 GCTGCAGGAGCGAGATCTCCAGG + Intronic
1019640034 7:2098458-2098480 GCAGCAGGGGAGAGGGACCCTGG - Intronic
1020212442 7:6166693-6166715 GCTGCAGGTGGGAGGAAGCCTGG + Intronic
1023361005 7:39414931-39414953 GCTTTAGGTGAGAGAGAACTTGG - Intronic
1023401655 7:39795925-39795947 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1023902090 7:44489760-44489782 GCCGCAGGTGAGGGTGATACGGG - Intronic
1024670260 7:51587811-51587833 CCTGCAGGTGAACGAGCTCCAGG + Intergenic
1025020790 7:55477530-55477552 GCTGCAGGTGAGGGAGGGGCGGG + Intronic
1026388758 7:69878519-69878541 CCTGCAGGAGAGAGATGTCCAGG + Intronic
1026897173 7:74016400-74016422 GAGGCAGCTGAGAGAAATCCAGG + Intergenic
1028160082 7:87475618-87475640 GTTCGAGGTGAGAGAGGTCCGGG - Exonic
1028618817 7:92801522-92801544 GGAGCAGTTCAGAGAGATCCTGG - Intronic
1028666461 7:93349237-93349259 CCTGCAGGTGAGAAAGAGCATGG + Intronic
1029033889 7:97498141-97498163 GCAGAAGGTGAGAGAGAGCAGGG - Intergenic
1029477929 7:100796190-100796212 GCAGCAGGGGTGAGAGATACAGG - Intronic
1029982796 7:104895020-104895042 TATGCAGGTGATCGAGATCCAGG + Intronic
1031294407 7:119983643-119983665 TCTGCATGGGAGAGAGGTCCTGG - Intergenic
1031334758 7:120514788-120514810 ACTACAGGTGAGAGGGATCTAGG - Intronic
1032339039 7:131054011-131054033 GGGGCAGGTGAGAGAGAAGCTGG - Intergenic
1032950637 7:136907028-136907050 GCTGCATATGTGAGAGATCTAGG - Intronic
1034478648 7:151303406-151303428 GCTGGAGGTGTAAGAGAACCTGG + Intergenic
1035663421 8:1363803-1363825 GCTGCGGGTGTGACAGAGCCCGG + Intergenic
1035727975 8:1836363-1836385 GGTGCAGGTGAGATGGACCCTGG - Intronic
1035769156 8:2133054-2133076 GCTGCAGGGGTGGGAGCTCCAGG + Intronic
1036210459 8:6836282-6836304 GCAGCAGGGGAGAGAGATTGGGG + Intergenic
1037886329 8:22598325-22598347 ACTGAAGATGAGAGAGAGCCTGG - Intronic
1038324866 8:26565404-26565426 GCTGCTGGTGAGAGTAGTCCAGG + Intronic
1038459766 8:27705929-27705951 GCTGGTGGTGAGAGAGAGCACGG + Intergenic
1038459769 8:27705987-27706009 GCTGGTGGTGAGAGAGAGCATGG + Intergenic
1042340026 8:67668974-67668996 GCTGCAGGTGAGGGAAGTCATGG + Intronic
1043090478 8:75895652-75895674 GCTGGAGCTGAGACAGATCAAGG - Intergenic
1045921612 8:107536766-107536788 GCTGCATGTGGCAGAGAGCCAGG + Intergenic
1046163496 8:110397699-110397721 ACTGCACGTGTGAGGGATCCAGG - Intergenic
1047131868 8:122030251-122030273 GCAGAAGATGAGAGGGATCCAGG - Intergenic
1047782421 8:128120838-128120860 GCAGGAGGAGAGAGAGATCGGGG - Intergenic
1047929670 8:129714053-129714075 GCTGCAGGGGAGAAAAACCCGGG + Intergenic
1048366141 8:133740325-133740347 GTTGCAGGTGAGAGAGGTACAGG - Intergenic
1048508583 8:135042446-135042468 TCTGCAGTTGAGACAGATCCTGG - Intergenic
1049434866 8:142581833-142581855 GCTGCAGGGGACAGACTTCCAGG + Intergenic
1049473810 8:142787796-142787818 GCTGAAGGTGAGTGGGAGCCGGG + Intergenic
1051379475 9:16440809-16440831 GCTTCTGGTGAAAGAGATCCAGG + Intronic
1054718035 9:68576838-68576860 CCTGCAGGCAAGAGACATCCTGG + Intergenic
1055785359 9:79864544-79864566 GCTGGTGGTAACAGAGATCCTGG - Intergenic
1055952033 9:81738366-81738388 GGTGCAGAGGAAAGAGATCCTGG + Intergenic
1056679109 9:88701776-88701798 GAGGCAGGTGAGAGAGAATCTGG - Intergenic
1057552757 9:96064083-96064105 GCTTCGGGTGAAACAGATCCAGG - Intergenic
1057865155 9:98674581-98674603 ACTGTAGGTGTGTGAGATCCAGG - Intronic
1058671231 9:107362060-107362082 ACTGCAGGTGTGAGAGTACCTGG - Intergenic
1059666447 9:116450748-116450770 GCTGCATGTGAGAGTGAGCAGGG - Intronic
1060187197 9:121570907-121570929 GCAGCAGGAGAGAGAGCCCCAGG - Intronic
1061111183 9:128572386-128572408 ACTGCAGGTTAGAGAGAGTCTGG - Intronic
1061325755 9:129863160-129863182 GGTGCAGGGGAGAGAGAGCCAGG - Intronic
1062059204 9:134485946-134485968 GCTGCAGGTCAGGGAGTGCCGGG + Intergenic
1062076088 9:134590717-134590739 GGTGGAGGTGAGAAAGACCCTGG + Intergenic
1062200698 9:135301273-135301295 GCTAGAGGTGAGAGAGTCCCAGG + Intergenic
1062277938 9:135739462-135739484 TCTGCAGGGGAGGGAGGTCCTGG - Intronic
1062565481 9:137162284-137162306 GCTTCAGGTGAGCGCGACCCGGG + Exonic
1185778783 X:2828777-2828799 GCTGCCGGGAAGAGAGACCCGGG - Intronic
1186578374 X:10790506-10790528 GCTGCAGGTAATGGACATCCAGG + Intronic
1186811347 X:13191643-13191665 GCTGAAGGTCAGAGAGGCCCAGG - Intergenic
1186846094 X:13532516-13532538 GATGCAGGTGATAGAGAAGCAGG + Intergenic
1187386332 X:18852150-18852172 GCTGCAACTGAGAGAGATGGTGG - Intergenic
1187813782 X:23209175-23209197 CCTGGAGGTGAGAGAGAACATGG - Intergenic
1198497261 X:137204943-137204965 GCAGCAGGAGAGAGAGAGCAGGG + Intergenic
1199203650 X:145122976-145122998 GAAGCAGGTGGGAGAGTTCCTGG + Intergenic
1199931977 X:152532027-152532049 GCAGCAGGAGAGAGAGATTAGGG + Intergenic
1201912290 Y:19145153-19145175 GCTGAAGGTGAGAGAGAGAATGG - Intergenic
1202269149 Y:23053674-23053696 GCTGCACTTGAGAGAGATGTAGG + Intergenic
1202373162 Y:24211600-24211622 GCTGCAGGTGACACAGGTACTGG + Intergenic
1202381427 Y:24278671-24278693 ACTGCAGGTGAAACAGATGCTGG - Intergenic
1202422141 Y:24687414-24687436 GCTGCACTTGAGAGAGATGTAGG + Intergenic
1202448645 Y:24982664-24982686 GCTGCACTTGAGAGAGATGTAGG - Intergenic
1202489358 Y:25391455-25391477 ACTGCAGGTGAAACAGATGCTGG + Intergenic
1202497620 Y:25458520-25458542 GCTGCAGGTGACACAGGTACTGG - Intergenic