ID: 1019404426

View in Genome Browser
Species Human (GRCh38)
Location 7:876338-876360
Sequence TCTGGGTCACGTGTTGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 2, 1: 4, 2: 2, 3: 24, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019404416_1019404426 12 Left 1019404416 7:876303-876325 CCGCCTCTGGGCCACGTGTTGCC 0: 1
1: 2
2: 9
3: 17
4: 141
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182
1019404417_1019404426 9 Left 1019404417 7:876306-876328 CCTCTGGGCCACGTGTTGCCTGC 0: 1
1: 5
2: 1
3: 14
4: 231
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182
1019404414_1019404426 21 Left 1019404414 7:876294-876316 CCTGCGGACCCGCCTCTGGGCCA 0: 1
1: 2
2: 2
3: 8
4: 117
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182
1019404415_1019404426 13 Left 1019404415 7:876302-876324 CCCGCCTCTGGGCCACGTGTTGC 0: 1
1: 2
2: 5
3: 20
4: 187
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182
1019404419_1019404426 1 Left 1019404419 7:876314-876336 CCACGTGTTGCCTGCGGACCCGC 0: 2
1: 0
2: 0
3: 4
4: 51
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182
1019404422_1019404426 -9 Left 1019404422 7:876324-876346 CCTGCGGACCCGCCTCTGGGTCA 0: 2
1: 3
2: 1
3: 3
4: 88
Right 1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG 0: 2
1: 4
2: 2
3: 24
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019404426 Original CRISPR TCTGGGTCACGTGTTGCCTG CGG Intronic
900677891 1:3900073-3900095 GCGGGGTCACGGGGTGCCTGTGG - Intronic
901031898 1:6311907-6311929 TCTGGGTCACCTGTCGGGTGGGG + Intronic
901239218 1:7683229-7683251 TCTGGGACAAGTGATGCCTTTGG - Intronic
902478374 1:16699675-16699697 TCTGGGTCACATCTGGCCGGGGG + Intergenic
902924961 1:19689978-19690000 TCTGGGTCACAGGTTTCATGTGG - Intronic
903930558 1:26859544-26859566 TCTGGGCCACATGCAGCCTGTGG - Intergenic
903936360 1:26897764-26897786 TCTGGCTCAAGTGTTGCTGGAGG - Intronic
907976167 1:59433445-59433467 TCTGGAGCACAGGTTGCCTGTGG + Intronic
909330421 1:74402785-74402807 CCTGGGCCACATGTAGCCTGTGG - Intronic
911331897 1:96534005-96534027 CCTGGGCCACATGTAGCCTGCGG + Intergenic
913358955 1:117957607-117957629 ACTGGGCCACATGTGGCCTGCGG - Intronic
913391540 1:118318521-118318543 TCTGGGCCGTGTGTTGCCTAAGG + Intergenic
915481014 1:156185104-156185126 TCTGGGGCCTGTGTTGTCTGAGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
918043110 1:180925217-180925239 TCTGGGTCATGTGCTCCATGAGG - Intronic
918214652 1:182383031-182383053 TCTGGTTCTTGTGTTGGCTGTGG - Exonic
918381543 1:183960676-183960698 CCTGGGCCACATGTGGCCTGCGG - Intronic
922192345 1:223330686-223330708 TCTGTGGCTCCTGTTGCCTGGGG - Intronic
922641334 1:227234826-227234848 TCTGGGCCACATGCGGCCTGTGG - Intronic
924146036 1:241075674-241075696 TCTGGGCCACATGCAGCCTGTGG + Intronic
924706384 1:246506522-246506544 TCTGGGTTGTGTGTGGCCTGGGG - Intronic
1065275520 10:24081785-24081807 CCTGGGCCACATGTGGCCTGGGG + Intronic
1066264456 10:33762148-33762170 TCTGGGTTGCCTGTGGCCTGTGG - Intergenic
1066794959 10:39109916-39109938 TCTGGGGCCTGTGTTGCTTGTGG - Intergenic
1067026712 10:42848483-42848505 GCTGGGTCACATGGTCCCTGTGG + Intergenic
1067741112 10:48896812-48896834 ACTGAGTCAGGTGTGGCCTGTGG - Intronic
1068968832 10:62941173-62941195 CCTGGGCCACATGTGGCCTGTGG - Intergenic
1071174130 10:82904122-82904144 CCTGGGCCACATGTGGCCTGTGG - Intronic
1071555017 10:86594811-86594833 CCTGGGCCACATGTGGCCTGCGG - Intergenic
1073407875 10:103313685-103313707 CCTGGGCCACATGTGGCCTGAGG + Intronic
1074274637 10:111989638-111989660 CCTGAGTCAGGTGTTGCCTGCGG - Intergenic
1074663554 10:115691015-115691037 TCTGCCTCAGGTGTTTCCTGTGG + Intronic
1074815071 10:117136972-117136994 TCCGGGTCCCCTGTAGCCTGAGG + Intronic
1075209146 10:120476180-120476202 TCAGGGACACGTTTTGCCTGGGG + Intronic
1075427141 10:122350667-122350689 TCTGGGACACCTGTTCCCTATGG + Intergenic
1075756947 10:124820325-124820347 ACTGGACCACGTGATGCCTGTGG - Intronic
1075852448 10:125600291-125600313 GCTGGCTCACGTGTAGGCTGAGG + Intronic
1084043442 11:66555658-66555680 CCTGGGGCACGTCCTGCCTGTGG + Intronic
1085254386 11:75164210-75164232 GCTGGGACAGGGGTTGCCTGAGG - Intronic
1087430987 11:98054949-98054971 TATGGGTAATGTGTTACCTGTGG - Intergenic
1092062725 12:5564403-5564425 GCTGGGTGAAGTGTGGCCTGGGG - Intronic
1094211036 12:27891902-27891924 TCTGGGCCACATGTGGCCTGTGG - Intergenic
1104069242 12:125330092-125330114 TCTGGGTCACGGGATGCGTGTGG + Intronic
1104330401 12:127839136-127839158 TCTGGGCCACATTTTCCCTGAGG + Intergenic
1111512605 13:89286829-89286851 TCTGTGTCCCGTGGTGCCTTTGG + Intergenic
1112394611 13:99017819-99017841 CCTGGGCCACATGTGGCCTGAGG + Intronic
1113995209 14:16058395-16058417 TCTGGGCCACGCGGTGCCTGGGG + Intergenic
1117245332 14:53879240-53879262 TATCAGTCACGTGATGCCTGAGG - Intergenic
1118417793 14:65561950-65561972 TCTGGGTCACCTGTGGCCCATGG - Intronic
1118852306 14:69593341-69593363 TCTGGAGCAGATGTTGCCTGTGG + Intergenic
1122320953 14:100855480-100855502 TCGGGGTCAAGAGTAGCCTGGGG + Intergenic
1122937086 14:104964976-104964998 TCTGGGCCACATGCGGCCTGTGG - Intronic
1123130920 14:105984699-105984721 TCTGGAGGACCTGTTGCCTGAGG - Intergenic
1123581151 15:21715920-21715942 TCTGGAGGACCTGTTGCCTGAGG - Intergenic
1123617800 15:22158543-22158565 TCTGGAGGACCTGTTGCCTGAGG - Intergenic
1126347860 15:47715991-47716013 TCTGGGTCAGAAGTTGGCTGGGG + Intronic
1127369293 15:58322261-58322283 CCTGGGCCACATGTGGCCTGTGG + Intronic
1127496750 15:59520010-59520032 CCTGGGTCGCATGTGGCCTGCGG - Intronic
1127564132 15:60169829-60169851 TCTGGGTCCCATGTTGTCAGGGG + Intergenic
1129710100 15:77816543-77816565 GCAGGGTCAGGTCTTGCCTGGGG + Intronic
1132554086 16:565055-565077 GCTGGGTCCCGTGTTGACCGGGG + Exonic
1133570874 16:7038715-7038737 TATTGGCCACGTGCTGCCTGGGG + Intronic
1134788596 16:16967524-16967546 TCTGGGTCACACGGTGTCTGTGG + Intergenic
1135234667 16:20744044-20744066 CCTGGGCCACATGTTGACTGTGG - Intronic
1137305107 16:47191315-47191337 CCTGGGCCACATGTGGCCTGCGG - Intronic
1139467213 16:67160303-67160325 TTTGTGCCACGTGTTTCCTGGGG - Intronic
1140659174 16:77170903-77170925 TGTGGGTGATGTTTTGCCTGTGG + Intergenic
1140930004 16:79618787-79618809 CCTGGGTGACTTGATGCCTGGGG - Intergenic
1142718409 17:1760655-1760677 TCTGGGCCACATGCAGCCTGTGG - Intergenic
1142832681 17:2560886-2560908 TCTGGGACACGTGTAGCCTCAGG + Intergenic
1143036752 17:4003980-4004002 TCTGGCCCAAGTGTGGCCTGAGG - Intergenic
1147997886 17:44371089-44371111 GCTGGCTCAGCTGTTGCCTGAGG - Intergenic
1149444282 17:56701473-56701495 GGTGGGCCACGTGTGGCCTGTGG - Intergenic
1149563659 17:57627058-57627080 TCTGGGTCACCTCTCTCCTGTGG - Intronic
1150843228 17:68628895-68628917 CCTGGGCCACATGTGGCCTGTGG - Intergenic
1151636895 17:75355688-75355710 CCTGGGCCACATGTGGCCTGCGG + Intronic
1151685869 17:75646323-75646345 TCTGGGTGACGTGTGGACTGCGG - Intronic
1152631525 17:81412820-81412842 TCAGGGCCAGGTGTTGGCTGGGG + Intronic
1153407151 18:4753633-4753655 CCTGGGCCACATGTGGCCTGTGG - Intergenic
1153485273 18:5591918-5591940 GCTGGGTCAACTGTTGTCTGAGG + Intronic
1153777563 18:8467066-8467088 TCTTTCTCACGTGTTGCATGGGG + Intergenic
1156879721 18:42062360-42062382 CCTGGGCCACATGTGGCCTGGGG - Intronic
1157327204 18:46677888-46677910 ACTGGGTCAAGTCATGCCTGGGG - Intronic
1157572966 18:48725105-48725127 TCTGGAACACGTGTTTGCTGTGG - Intronic
1158010859 18:52725608-52725630 TGTGGGGGAGGTGTTGCCTGTGG + Intronic
1159053912 18:63446566-63446588 TGTAGGTCTCCTGTTGCCTGGGG + Intergenic
1160147775 18:76378809-76378831 TGGGGGTCACATGTGGCCTGGGG + Intronic
1161296147 19:3521222-3521244 GCTGGGTCATGTGGTGACTGTGG + Intronic
1162034600 19:7932239-7932261 TCTGGGTCAGACGTGGCCTGGGG + Intronic
1162741254 19:12775140-12775162 GCCTGGTCACGTGGTGCCTGTGG - Intronic
1166344290 19:42155780-42155802 TCTGTGTTGAGTGTTGCCTGTGG - Intronic
1167009850 19:46800287-46800309 TCTGGGTCACGTGTCTCCCCAGG + Intergenic
1202712396 1_KI270714v1_random:25506-25528 TCTGGGTCACATCTGGCCGGGGG + Intergenic
925324586 2:3007911-3007933 TCTCGGGCACCTGGTGCCTGGGG + Intergenic
926756206 2:16238118-16238140 TCTAGGTGATGTGTTCCCTGTGG - Intergenic
929226527 2:39516655-39516677 TCTGGGTCACTTCCTGCCTTTGG - Intergenic
932383399 2:71306949-71306971 CCTGGGTCATGTGTCTCCTGTGG + Intronic
933763785 2:85693901-85693923 TCTGGGACTCGTGTCCCCTGTGG - Intronic
938703824 2:133902376-133902398 TCTGGGTCATGTTTTTCCTTTGG + Intergenic
939374730 2:141349740-141349762 TCTGGGACAGGAGTTGGCTGTGG + Intronic
939483320 2:142777546-142777568 TCTGGGCCACCTGAAGCCTGGGG + Intergenic
940441007 2:153716261-153716283 CCTGGGCCACGTGTGGCCAGTGG - Intergenic
943553412 2:189370573-189370595 TCTGTGTCACGTGTTGTGTGTGG - Intergenic
945599865 2:211847556-211847578 TCTGGGCCACATGTGGCCTGTGG - Intronic
946002260 2:216492402-216492424 GCTGGGTCAGCTCTTGCCTGTGG + Intergenic
946134482 2:217634467-217634489 TGTGGGTCACGTGCAGCGTGTGG - Intronic
946163772 2:217851556-217851578 TCTGGGGCTGGTGTTGGCTGAGG - Intronic
946494500 2:220182091-220182113 TCTGGGCCACATGTGGCCCGTGG - Intergenic
946961954 2:224994936-224994958 TCTGGCTCAAGTGTTTCCTGAGG + Intronic
947298605 2:228662926-228662948 CCTGGGTCACATGTGGCCTGCGG - Intergenic
948234073 2:236374196-236374218 TTTGGTGCAAGTGTTGCCTGGGG + Intronic
1168984815 20:2039030-2039052 TCTGGGTGATGTGATGCCAGAGG + Intergenic
1169169583 20:3453927-3453949 TCTGGGTCACATGCAGCCTGCGG + Intergenic
1169348746 20:4851117-4851139 CCTGGGTCGCATGTGGCCTGTGG + Intergenic
1169792896 20:9430175-9430197 CCTGGGCCACATGTGGCCTGTGG + Intronic
1170782137 20:19435623-19435645 GCTGGGTCACTCTTTGCCTGGGG - Intronic
1173363545 20:42365743-42365765 TTTGGGTCGCATGTAGCCTGTGG + Intronic
1174066548 20:47869894-47869916 TCTGGGCCACATGTGGCCTGCGG + Intergenic
1175728175 20:61333639-61333661 TGTGGGCCACGTGTGGCCCGGGG - Intronic
1175830010 20:61958927-61958949 GCTGGATCACGTGGTGACTGAGG + Intronic
1176423848 21:6535708-6535730 CCTTGGTCACGTGTGGTCTGGGG + Intergenic
1177104100 21:16933140-16933162 TCTGGGCCACATGTGGCCTGTGG - Intergenic
1179306551 21:40158557-40158579 TCTGTGGCACGTGTTGCATCTGG - Intronic
1179699341 21:43144023-43144045 CCTTGGTCACGTGTGGTCTGGGG + Intergenic
1179883062 21:44301405-44301427 TCTGGGTCACGCCTTTCCTGTGG + Intronic
1179939495 21:44628607-44628629 CCTGAGTCACGTGGTGTCTGTGG - Intronic
1180311883 22:11249014-11249036 TCTGGGCCACGCGGTGCCTGGGG - Intergenic
1180618782 22:17146247-17146269 CCTGGGGCAGGAGTTGCCTGTGG - Intronic
950342141 3:12257192-12257214 TCTGGGCCACATGCAGCCTGTGG + Intergenic
951753711 3:26066150-26066172 TCTGAATCATGCGTTGCCTGAGG - Intergenic
953255962 3:41290709-41290731 TCTAGGTCATGTGCTCCCTGTGG + Intronic
954962094 3:54575692-54575714 GCTGGGTCATGTATCGCCTGGGG + Intronic
958491242 3:94776590-94776612 TCTGGGTCAGCTGTTGTCTTGGG + Intergenic
959202674 3:103269060-103269082 TCTGGGTCACGGGTTTCATCTGG + Intergenic
963040476 3:141066329-141066351 TCTGGGCCACGGGGTGCCGGTGG - Exonic
968746566 4:2363469-2363491 TGGGGGTCACGTGGTCCCTGAGG + Intronic
968913452 4:3487015-3487037 GCTGGCCCACGTGCTGCCTGCGG - Intronic
969267367 4:6073344-6073366 TCTGGGTCTGCTGTTGCCAGGGG - Intronic
972930193 4:44063011-44063033 TCTGGGCCACATGTGGCCCGTGG - Intergenic
976445466 4:85126146-85126168 TCTGGGGCCTGTGTTGTCTGTGG + Intergenic
977065393 4:92306320-92306342 GCTGGATCCCGTTTTGCCTGGGG + Intronic
977577268 4:98688575-98688597 TCTGAGTCACGTTTTGTCAGAGG - Intergenic
978690844 4:111507478-111507500 TCTGGGTCAGTTGTTGACAGTGG + Intergenic
980664498 4:135912298-135912320 TCTGGGTCACCTGTTTTCTCTGG + Intergenic
981996225 4:150977949-150977971 TCAGGGTAGCGTGTTTCCTGAGG - Intronic
983146630 4:164224091-164224113 CCTGGGCCACATGTGGCCTGTGG - Intronic
983366200 4:166793524-166793546 CCTGGGCCACATGTGGCCTGTGG + Intronic
983968317 4:173841863-173841885 TGTGGGCCACGTGGTGCCTATGG + Intergenic
984255081 4:177381489-177381511 TCTGGGTCACGTTTTTCATCCGG + Intergenic
987883232 5:23776880-23776902 TCTGGATCACGAGTTCCCTCAGG - Intergenic
989142616 5:38216918-38216940 CCTGGGTCACATGCAGCCTGTGG + Intergenic
995044464 5:107629693-107629715 CCTGGGCCACATGTGGCCTGTGG - Intronic
997690262 5:135823347-135823369 TCTGGGCCACGTGTCCCCTCTGG + Intergenic
998392231 5:141794832-141794854 GCTGGGTCATGTGCTGCCTCTGG + Intergenic
1001101730 5:168819869-168819891 TCTGGGTCACCTCTTTCCTCTGG - Intronic
1001231398 5:169991610-169991632 TTTGAGTCACGTGTTGGCTCTGG + Intronic
1002003502 5:176213263-176213285 TCTGGGTCCCCTGGTACCTGGGG - Intergenic
1002222954 5:177697653-177697675 TCTGGGTCCCCTGGTACCTGGGG + Intergenic
1002840457 6:900739-900761 TCAGGGTCACACGTTGCCTGTGG - Intergenic
1003114005 6:3271333-3271355 TCTTGGCCACGTGTTTCCAGTGG - Exonic
1007051210 6:38832017-38832039 TCTGGGTCACATGTTGTCTGTGG - Intronic
1008023338 6:46605095-46605117 CCTGGGCCACATGTGGCCTGCGG + Intronic
1011585171 6:88916969-88916991 TCTGAATCACCTGTTTCCTGTGG + Intronic
1012246067 6:96926877-96926899 TCTGGGTCATATCTAGCCTGTGG + Intronic
1013052848 6:106554043-106554065 CCTGGGTCTTGTGTTTCCTGTGG - Intronic
1015605062 6:134945767-134945789 TGTGGGTCAGGTTTTGCATGAGG - Intronic
1015961642 6:138656053-138656075 TCAGAGTCACGAGTTGCCTGCGG - Intronic
1016509894 6:144830615-144830637 CCTGGGCCACATGTGGCCTGTGG - Intronic
1018201011 6:161395772-161395794 GCTGGGTCAGGAGTGGCCTGTGG + Intronic
1018892318 6:167990705-167990727 TCGGGGTCGCGCGCTGCCTGCGG - Intergenic
1019012999 6:168857617-168857639 TCTGTGTCAGTGGTTGCCTGGGG + Intergenic
1019404410 7:876278-876300 CCTGGGCCACGTGTTGCCTGCGG + Intronic
1019404418 7:876308-876330 TCTGGGCCACGTGTTGCCTGCGG + Intronic
1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404433 7:876368-876390 TCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404443 7:876398-876420 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404452 7:876428-876450 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404461 7:876458-876480 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019825196 7:3278913-3278935 CCTGGGCCACATGTGGCCTGTGG + Intergenic
1021696970 7:23285322-23285344 CCTGGGTCATGTGTGGCCCGTGG - Intergenic
1023743933 7:43304413-43304435 TGTGGGTAACGTGTGGGCTGGGG - Intronic
1032146903 7:129391826-129391848 TCTGGGTTATGTGTTCTCTGAGG + Intronic
1032385067 7:131516700-131516722 TGTGGGTCACGCTTTGACTGTGG + Intronic
1032771066 7:135057198-135057220 TCTAGTTCACATTTTGCCTGTGG - Intronic
1033427557 7:141258416-141258438 TCTGGGCCACATGTGGCCTGTGG + Intronic
1033887083 7:145962314-145962336 TCTGGGGCACCTGGTGCCTGAGG + Intergenic
1034939014 7:155218481-155218503 TCTGGCTCCAGAGTTGCCTGCGG - Intergenic
1035072616 7:156156463-156156485 TCTGAGTCTGCTGTTGCCTGTGG + Intergenic
1035382829 7:158450760-158450782 TGTGGGTCACGTCCAGCCTGGGG + Intronic
1035419101 7:158712163-158712185 TCTGGCTCACGTTGTCCCTGAGG - Intergenic
1039701144 8:39962966-39962988 TCTGGGTCACGGGTTTCATCTGG + Intronic
1041376008 8:57209903-57209925 TCTGGAGCACTTGTGGCCTGGGG + Intergenic
1041376775 8:57214282-57214304 TCTGGAGCACTTGTGGCCTGGGG + Intergenic
1041531654 8:58874971-58874993 CCTGGGCCACATGTGGCCTGTGG + Intronic
1041770215 8:61465087-61465109 TCTGGGCAGCGTGTTCCCTGTGG + Intronic
1042708658 8:71690480-71690502 TCTGGGTTACATGCAGCCTGTGG + Intergenic
1042951914 8:74209257-74209279 CCTGGGTCACATGTAGCCCGTGG - Intergenic
1045584575 8:103518436-103518458 TCTGGGCCACATGTGGCCTGCGG + Intronic
1049241555 8:141540025-141540047 TCTGGGTCAGGAGCTCCCTGGGG + Intergenic
1052494062 9:29204453-29204475 CCTGGGTCACATATTGTCTGTGG - Intergenic
1054720151 9:68595904-68595926 CCTGGGTCACATGTGGCCTGTGG + Intergenic
1055405208 9:75966971-75966993 TCTGGGTCACAGGTAGCCTTAGG + Intronic
1056461303 9:86812173-86812195 TCTGGTTCAGGTGTCTCCTGTGG + Intergenic
1060854850 9:126907024-126907046 ACGGGGGCATGTGTTGCCTGTGG + Intergenic
1061370196 9:130193571-130193593 TTTGGGCCACGTGGAGCCTGAGG + Intronic
1061595427 9:131625960-131625982 TCTGGGTCACCGGTTGACTCAGG + Exonic
1062038833 9:134394996-134395018 TCTTGGTCACGTGGAACCTGGGG + Intronic
1062288500 9:135784358-135784380 TGTGGGTCATGTGGTGCTTGGGG + Intronic
1062390314 9:136331242-136331264 TCAGGGCCACGTGGGGCCTGGGG - Intronic
1185431658 X:14803-14825 TCTGGGCCATGTGCTGCCTGGGG - Intergenic
1185440982 X:227522-227544 TCTGGGCCATGTGCTGCCTGGGG - Intergenic
1193524434 X:82572343-82572365 TCTGGCACACCTGTGGCCTGGGG - Intergenic
1195094478 X:101491457-101491479 TCAGGGTGAGGTCTTGCCTGGGG + Exonic
1201401790 Y:13611412-13611434 TCTGGGACCTGTGTTGTCTGAGG - Intergenic