ID: 1019412341

View in Genome Browser
Species Human (GRCh38)
Location 7:911832-911854
Sequence GAGCCGACACCCACCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019412328_1019412341 21 Left 1019412328 7:911788-911810 CCACGGAGGGCCAGGAAGGGGGC 0: 8
1: 0
2: 5
3: 42
4: 393
Right 1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG No data
1019412333_1019412341 11 Left 1019412333 7:911798-911820 CCAGGAAGGGGGCGGGGGACCCA 0: 1
1: 8
2: 1
3: 32
4: 315
Right 1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG No data
1019412338_1019412341 -8 Left 1019412338 7:911817-911839 CCCACGGAGGGCCAGGAGCCGAC 0: 1
1: 0
2: 2
3: 7
4: 75
Right 1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG No data
1019412339_1019412341 -9 Left 1019412339 7:911818-911840 CCACGGAGGGCCAGGAGCCGACA 0: 1
1: 0
2: 3
3: 12
4: 122
Right 1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG No data
1019412326_1019412341 22 Left 1019412326 7:911787-911809 CCCACGGAGGGCCAGGAAGGGGG 0: 8
1: 0
2: 0
3: 23
4: 275
Right 1019412341 7:911832-911854 GAGCCGACACCCACCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019412341 Original CRISPR GAGCCGACACCCACCCAGAG AGG Intronic
No off target data available for this crispr