ID: 1019414754

View in Genome Browser
Species Human (GRCh38)
Location 7:922134-922156
Sequence GTGTCAGTGCGGCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019414754_1019414766 8 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414766 7:922165-922187 GTCACGAGGAGGTGGGCTTCGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1019414754_1019414768 23 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414768 7:922180-922202 GCTTCGGGCCACCTGGCAGCCGG No data
1019414754_1019414769 24 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414769 7:922181-922203 CTTCGGGCCACCTGGCAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 197
1019414754_1019414759 -3 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414759 7:922154-922176 CACCCCACGTGGTCACGAGGAGG No data
1019414754_1019414762 0 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414762 7:922157-922179 CCCACGTGGTCACGAGGAGGTGG No data
1019414754_1019414765 7 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414765 7:922164-922186 GGTCACGAGGAGGTGGGCTTCGG No data
1019414754_1019414764 1 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414764 7:922158-922180 CCACGTGGTCACGAGGAGGTGGG No data
1019414754_1019414758 -6 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414758 7:922151-922173 TGACACCCCACGTGGTCACGAGG No data
1019414754_1019414770 28 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414770 7:922185-922207 GGGCCACCTGGCAGCCGGGACGG 0: 1
1: 0
2: 2
3: 37
4: 338
1019414754_1019414767 16 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414767 7:922173-922195 GAGGTGGGCTTCGGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019414754 Original CRISPR GTGTCAGTGCGGCCCCTCCA GGG (reversed) Intronic