ID: 1019414754

View in Genome Browser
Species Human (GRCh38)
Location 7:922134-922156
Sequence GTGTCAGTGCGGCCCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019414754_1019414770 28 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414770 7:922185-922207 GGGCCACCTGGCAGCCGGGACGG 0: 1
1: 0
2: 2
3: 37
4: 338
1019414754_1019414768 23 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414768 7:922180-922202 GCTTCGGGCCACCTGGCAGCCGG No data
1019414754_1019414764 1 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414764 7:922158-922180 CCACGTGGTCACGAGGAGGTGGG No data
1019414754_1019414767 16 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414767 7:922173-922195 GAGGTGGGCTTCGGGCCACCTGG No data
1019414754_1019414759 -3 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414759 7:922154-922176 CACCCCACGTGGTCACGAGGAGG No data
1019414754_1019414765 7 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414765 7:922164-922186 GGTCACGAGGAGGTGGGCTTCGG No data
1019414754_1019414758 -6 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414758 7:922151-922173 TGACACCCCACGTGGTCACGAGG No data
1019414754_1019414766 8 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414766 7:922165-922187 GTCACGAGGAGGTGGGCTTCGGG 0: 1
1: 0
2: 0
3: 7
4: 142
1019414754_1019414769 24 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414769 7:922181-922203 CTTCGGGCCACCTGGCAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 197
1019414754_1019414762 0 Left 1019414754 7:922134-922156 CCCTGGAGGGGCCGCACTGACAC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1019414762 7:922157-922179 CCCACGTGGTCACGAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019414754 Original CRISPR GTGTCAGTGCGGCCCCTCCA GGG (reversed) Intronic
902172606 1:14625089-14625111 GTGTCGGGGGGGACCCTCCAGGG - Intronic
905998714 1:42404596-42404618 GGGTCAGTGCCACCTCTCCAGGG + Exonic
907158424 1:52354764-52354786 TTGTCACTGCTGCCCCTGCATGG - Intronic
911170747 1:94768814-94768836 GTGTCACTGTGTCCCCTTCAGGG - Intergenic
919980158 1:202637893-202637915 ATGTCACTGTGGCCCCTTCAGGG + Intronic
920854797 1:209653495-209653517 GTGCCAGTGCAGGCTCTCCAGGG - Intergenic
924425304 1:243944751-243944773 GTGTTAGTGTGGCATCTCCAAGG - Intergenic
1062940570 10:1417784-1417806 GTGCCATGGCTGCCCCTCCAGGG + Intronic
1070766855 10:79061711-79061733 CTGACGGTGCAGCCCCTCCACGG - Intergenic
1073834568 10:107426220-107426242 GTGTCAGTGCCTCACCTGCACGG - Intergenic
1074763870 10:116686616-116686638 GTGGCAGTGAGGCCCCCACAGGG + Intronic
1076071762 10:127496119-127496141 GCGTCAGTTCGGCTCCTCCATGG + Intergenic
1077233376 11:1468569-1468591 GAGTCAGTGCGGGCCCTCGTGGG + Intergenic
1078476865 11:11637796-11637818 GTGCCTGTACTGCCCCTCCAGGG + Intergenic
1081540506 11:44031297-44031319 ATGTCAGTCCGGCTCCCCCAGGG + Intergenic
1081814394 11:45930399-45930421 CTGCCAGGGCGGCCCCACCAGGG + Intronic
1081935265 11:46899627-46899649 GAGTCAGTGCAGACTCTCCAGGG + Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1085413852 11:76307403-76307425 GGGTCAGGCCGGCCCCCCCATGG + Intergenic
1087188747 11:95230909-95230931 CTGTCACTGCGGCCACTGCAGGG + Exonic
1091339292 11:134797928-134797950 GTGTCAGTGCGGGGCCTCCGCGG + Intergenic
1091699901 12:2652518-2652540 GGCTGAGAGCGGCCCCTCCATGG - Intronic
1092548124 12:9469205-9469227 ATGTCAGTGAGACCACTCCATGG - Intergenic
1101724148 12:107375532-107375554 GGGCCAGTGGGGCACCTCCAGGG + Intronic
1101999935 12:109551027-109551049 GTGCCAGGGCGGCCACCCCACGG + Intergenic
1104076680 12:125396123-125396145 GTGTGAGTGTGGCTCCTCAATGG + Intronic
1106165730 13:27244401-27244423 GTGACACTGCTGCTCCTCCAGGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107130207 13:36886790-36886812 GAGAAAGTGCGGCCACTCCAGGG + Intronic
1108076738 13:46687940-46687962 GTGTAAATGTGGCCTCTCCATGG - Exonic
1113435219 13:110286132-110286154 TTGTCAGTATTGCCCCTCCATGG - Intronic
1118597413 14:67446590-67446612 GTGACTGTGCTGCCCCTCCTGGG - Intergenic
1119657435 14:76427190-76427212 GTGTCAGGGCTGCCTCTCCAGGG - Intronic
1124495771 15:30185938-30185960 ATGTCACTGTGGCCCCTTCAGGG + Intergenic
1124747802 15:32352708-32352730 ATGTCACTGTGGCCCCTTCAGGG - Intergenic
1125503269 15:40252584-40252606 GTGTAAGCGCGGCCCCTCCTCGG + Intronic
1127398662 15:58564045-58564067 ATGTCAGTGCTGCCAGTCCAAGG + Intronic
1128765431 15:70248319-70248341 GTGACACTGCAGCCCCTCCTCGG - Intergenic
1129411723 15:75354170-75354192 GTGTGAGTCCTGCCTCTCCAAGG + Intronic
1130306526 15:82715350-82715372 GTGTGAGTGTGGCCACTGCAAGG - Intergenic
1130424748 15:83785222-83785244 ATGTCAGTGCTGCCTGTCCATGG + Intronic
1133292057 16:4728797-4728819 CAGTCAGTACGGCCCCTCAAAGG - Intronic
1134520884 16:14918752-14918774 GGGTCCGTGGGGCCCCACCAGGG - Intronic
1134550689 16:15137221-15137243 GGGTCCGTGGGGCCCCACCAGGG + Intronic
1134708559 16:16317403-16317425 GGGTCCGTGGGGCCCCACCAGGG - Intergenic
1134715772 16:16357436-16357458 GGGTCCGTGGGGCCCCACCAGGG - Intergenic
1134951045 16:18351242-18351264 GGGTCCGTGGGGCCCCACCAGGG + Intergenic
1134958985 16:18394723-18394745 GGGTCCGTGGGGCCCCACCAGGG + Intergenic
1140760432 16:78104029-78104051 GTCTCAGAGCAGCCCCTTCATGG + Intronic
1142133197 16:88440229-88440251 GGGTCAGGGAGGCCCCACCATGG + Exonic
1142204781 16:88777809-88777831 GGGTCCTTGAGGCCCCTCCAGGG + Intronic
1142376898 16:89711234-89711256 GTGTCAGTCCAGCCCCTCTCCGG + Intronic
1142979301 17:3662554-3662576 GTGTCCCTACGGCCCCTCCCAGG + Intergenic
1143164146 17:4889581-4889603 GCGTCAGCACTGCCCCTCCATGG - Intronic
1144678897 17:17179769-17179791 GTGTATGTGGGGCCCCGCCAGGG - Intronic
1145773519 17:27510253-27510275 GTGGCGGTGCTGCCCCACCAGGG + Intronic
1146640058 17:34533639-34533661 GTGTCACTCTGGCCCCACCATGG - Intergenic
1146931699 17:36782528-36782550 GTGGCACAGCGGCACCTCCATGG - Intergenic
1147946561 17:44083672-44083694 GTTTCAGTGTGCCCCCTGCAGGG + Intronic
1151890422 17:76947992-76948014 GTGTCGGTGCAGGCCCTCCCAGG - Exonic
1152723300 17:81933270-81933292 GTGACAGAGCGGTCCCTGCAGGG + Exonic
1153553251 18:6284559-6284581 CGGCCAGTGCGTCCCCTCCAAGG - Intronic
1153617168 18:6945790-6945812 GTCTCAGTGTTGCCCCTGCATGG - Intronic
1154367760 18:13726787-13726809 GTGCCAGTTCCACCCCTCCACGG - Intronic
1160583471 18:79900460-79900482 GTGGCATTGCAACCCCTCCATGG + Intergenic
1160630646 18:80244986-80245008 AGGTCAGTGTGGCCCTTCCAAGG + Intronic
1161988330 19:7669852-7669874 GTGCCAGAGCGTCACCTCCAGGG + Exonic
1168324991 19:55533961-55533983 TTGCCAATGAGGCCCCTCCATGG - Intronic
925362371 2:3288563-3288585 GTGTCACTGTGGCCCTTACAGGG + Intronic
927683249 2:25154031-25154053 GTGTCACTGCGGAGCCTGCAGGG + Intronic
927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG + Intronic
933666912 2:84971416-84971438 GTGGCGGCGCGGCCCCTCCCGGG - Exonic
936081005 2:109432456-109432478 GTGTCAGTGGGAGCCCTCCTGGG - Intronic
936248971 2:110852672-110852694 GGGTTTGTGCTGCCCCTCCAGGG - Intronic
936427697 2:112434629-112434651 GTGTCTGTGCGCCCCTTCCTTGG + Intergenic
939776460 2:146393384-146393406 GGGTCCCTGCGGCCCCTCCCAGG + Intergenic
948133748 2:235620567-235620589 GTGTCATTGAGGACCCTCCGTGG + Intronic
948912266 2:241010598-241010620 GGGTCAGAGCATCCCCTCCATGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172194870 20:33084923-33084945 GTGTCCGTGCGGCTCCTGCCCGG + Exonic
1172195851 20:33090854-33090876 GTATCAGTGAGGCCCTCCCAGGG + Intronic
1173261679 20:41441942-41441964 GAGTGACTGCTGCCCCTCCAAGG - Intronic
1175672797 20:60920469-60920491 AATTCAGTGCAGCCCCTCCATGG - Intergenic
1176254757 20:64146176-64146198 GTCTCAGAGCAGCCCCTCCTGGG + Intergenic
1176374546 21:6080583-6080605 GTGTCTGTGCGCCCCTTCCTTGG - Intergenic
1179748929 21:43457662-43457684 GTGTCTGTGCGCCCCTTCCTTGG + Intergenic
1179839542 21:44062475-44062497 GTGCCAGTGCCGCCCCCACAGGG - Intronic
1181542254 22:23579860-23579882 GTGTCTGTGGCTCCCCTCCAGGG + Intronic
1184893514 22:47393688-47393710 AGGTCAGAGCAGCCCCTCCAAGG + Intergenic
1184996600 22:48211645-48211667 GTGTCAGTGTGGGACCTCCCAGG + Intergenic
949263498 3:2130288-2130310 GTGTCAGTTCTGGCCCTCAATGG - Intronic
957553407 3:81735608-81735630 GTGGCACTGCGGTCCCCCCAGGG + Intronic
961628745 3:128281333-128281355 GAGTGATTGCAGCCCCTCCAGGG + Intronic
966232175 3:177664575-177664597 GTGTCAGTCCGCCCCCTACTGGG + Intergenic
968047173 3:195630959-195630981 GGGACAGTGCTGACCCTCCAGGG - Intergenic
968307474 3:197659085-197659107 GGGACAGTGCTGACCCTCCAGGG + Intergenic
968808742 4:2790718-2790740 ACGTCGGTGCGGCCCCGCCAGGG - Intergenic
968939942 4:3632497-3632519 GTGGCACTGCGGCCTCCCCATGG + Intergenic
969314575 4:6374024-6374046 GTGTTAGTGTGACTCCTCCAAGG + Intronic
969608281 4:8212963-8212985 GTATCACAGCCGCCCCTCCAAGG - Intronic
969848069 4:9935351-9935373 GTGTCATTGCTCCCCCTCCGAGG - Intronic
978545953 4:109872983-109873005 GAGACAGTGCGGCTTCTCCAGGG + Intergenic
982838799 4:160156585-160156607 GTGTCAGTTCTGCCCCTACTGGG + Intergenic
983972508 4:173892394-173892416 GTTGCAGTGCTGACCCTCCAGGG + Intergenic
985744213 5:1637293-1637315 GGGACAGTGCTGACCCTCCAAGG - Intergenic
990245814 5:53862391-53862413 GTGACAGCAAGGCCCCTCCAAGG - Intergenic
997471717 5:134120913-134120935 GTGCCAGTGCGGCCTGGCCAGGG + Intronic
997727462 5:136133264-136133286 GGGTCAGGGGGTCCCCTCCAGGG - Intronic
1001066029 5:168535796-168535818 GTGTGCATGAGGCCCCTCCAGGG - Intergenic
1011260605 6:85466135-85466157 TTGTCAGTGGGGCCTCTGCATGG + Intronic
1018934553 6:168265234-168265256 GTGTCAGTCCAGCGCCTCCCAGG - Intergenic
1019181997 6:170193355-170193377 GCTTCTGGGCGGCCCCTCCAGGG - Intergenic
1019359023 7:595296-595318 GGGTCTCTGAGGCCCCTCCACGG + Intronic
1019414754 7:922134-922156 GTGTCAGTGCGGCCCCTCCAGGG - Intronic
1019515355 7:1437601-1437623 GTGTCTGTGCGGCAGGTCCAAGG - Exonic
1021156427 7:17215947-17215969 GTGTCAGTCTGGCCCCTACTTGG - Intergenic
1023938275 7:44754945-44754967 GTGCCAGTGAGGGCCCTTCAGGG + Intronic
1024548273 7:50540014-50540036 GTGCCAGTGCGTCACCTGCATGG + Exonic
1033254002 7:139783785-139783807 GTGACAGTCAAGCCCCTCCAGGG - Intronic
1035391414 7:158507180-158507202 ATGTCAGTGAGGACCGTCCAGGG + Intronic
1035581210 8:739880-739902 GTGTCACCTCGGTCCCTCCACGG - Intergenic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1041073029 8:54143698-54143720 GTGTCCGTGCTGCTCCTGCAAGG + Intronic
1045017309 8:98010672-98010694 GTGTCTCTGGGGCCCCTCCAAGG - Intronic
1049439436 8:142602500-142602522 GTGTCAGTGGGACCCAGCCATGG + Intergenic
1054450809 9:65402778-65402800 GTGGCACTGCGGCCTCCCCATGG - Intergenic
1057019111 9:91681915-91681937 GGGTCCGTGCGGCGCCTCCGCGG - Intronic
1057190599 9:93084888-93084910 ATGTCAGCTCGGCCCCTCAAGGG - Exonic
1185760183 X:2684561-2684583 GTGTCTGTGAGACTCCTCCATGG + Intergenic
1189364675 X:40379423-40379445 GTGTCAGTGAGGGCCCTTTATGG - Intergenic
1190929431 X:54935150-54935172 CTCTCAGTGCTGCCCCTGCAGGG - Intronic
1190978071 X:55427272-55427294 GTGTCAGTCCGCCCCCTACTGGG - Intergenic
1200585729 Y:5003053-5003075 GTGTCCCTTCGGCCCCTCCTGGG + Intronic
1201341796 Y:12942282-12942304 GTGCCAGTGCAGCCCCTGCAGGG - Intergenic