ID: 1019417101

View in Genome Browser
Species Human (GRCh38)
Location 7:932773-932795
Sequence CGAAGGCGGTGAGCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019417097_1019417101 -3 Left 1019417097 7:932753-932775 CCAGGTCAGTGAAGGTGGGTCGA 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417087_1019417101 12 Left 1019417087 7:932738-932760 CCCAGTGTCCCCCACCCAGGTCA No data
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417091_1019417101 3 Left 1019417091 7:932747-932769 CCCCACCCAGGTCAGTGAAGGTG No data
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417090_1019417101 4 Left 1019417090 7:932746-932768 CCCCCACCCAGGTCAGTGAAGGT No data
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417092_1019417101 2 Left 1019417092 7:932748-932770 CCCACCCAGGTCAGTGAAGGTGG 0: 1
1: 0
2: 2
3: 23
4: 171
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417088_1019417101 11 Left 1019417088 7:932739-932761 CCAGTGTCCCCCACCCAGGTCAG 0: 1
1: 1
2: 4
3: 39
4: 356
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417094_1019417101 1 Left 1019417094 7:932749-932771 CCACCCAGGTCAGTGAAGGTGGG No data
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97
1019417096_1019417101 -2 Left 1019417096 7:932752-932774 CCCAGGTCAGTGAAGGTGGGTCG 0: 1
1: 1
2: 0
3: 7
4: 79
Right 1019417101 7:932773-932795 CGAAGGCGGTGAGCCCAAGGTGG 0: 1
1: 0
2: 1
3: 1
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019417101 Original CRISPR CGAAGGCGGTGAGCCCAAGG TGG Intronic