ID: 1019417716

View in Genome Browser
Species Human (GRCh38)
Location 7:934979-935001
Sequence TGGGTCGTGCCGCGCGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019417708_1019417716 19 Left 1019417708 7:934937-934959 CCGGGGTGCACGTGGACTGCCGT No data
Right 1019417716 7:934979-935001 TGGGTCGTGCCGCGCGGCCTGGG No data
1019417709_1019417716 0 Left 1019417709 7:934956-934978 CCGTGTAAATGCGACCCTGACTC No data
Right 1019417716 7:934979-935001 TGGGTCGTGCCGCGCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019417716 Original CRISPR TGGGTCGTGCCGCGCGGCCT GGG Intronic