ID: 1019418472

View in Genome Browser
Species Human (GRCh38)
Location 7:937764-937786
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019418467_1019418472 0 Left 1019418467 7:937741-937763 CCCGGCCTCTGGGATTTGGGGGT 0: 13
1: 11
2: 5
3: 30
4: 272
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112
1019418457_1019418472 27 Left 1019418457 7:937714-937736 CCCGACCTCTGGGATTTGGGGGT 0: 9
1: 15
2: 5
3: 28
4: 201
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112
1019418458_1019418472 26 Left 1019418458 7:937715-937737 CCGACCTCTGGGATTTGGGGGTC 0: 9
1: 10
2: 6
3: 16
4: 190
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112
1019418459_1019418472 22 Left 1019418459 7:937719-937741 CCTCTGGGATTTGGGGGTCATGC 0: 6
1: 18
2: 2
3: 23
4: 217
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112
1019418469_1019418472 -5 Left 1019418469 7:937746-937768 CCTCTGGGATTTGGGGGTCACGC 0: 15
1: 6
2: 4
3: 12
4: 116
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112
1019418468_1019418472 -1 Left 1019418468 7:937742-937764 CCGGCCTCTGGGATTTGGGGGTC 0: 9
1: 12
2: 4
3: 27
4: 237
Right 1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG 0: 2
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900918783 1:5657784-5657806 CACTCTGCTCATCTGGAAATGGG + Intergenic
902193619 1:14781514-14781536 CAAACTGAACATCTGGAATTTGG + Intronic
902451161 1:16498125-16498147 CACCCTGAACTTCTGGGATGCGG - Intergenic
906642657 1:47450622-47450644 CACCCTGCACCTCTGGGAGGAGG + Intergenic
912400110 1:109383617-109383639 CAGACTGCCCATCTAGGATTAGG + Intronic
924134650 1:240950887-240950909 AAAGCTGCACATCTTGTATTAGG - Intronic
1065044321 10:21732388-21732410 CATGCTGAGCAGCTGGGATTAGG + Intronic
1072906761 10:99461261-99461283 GAGGCTGCACATCTGAGATCAGG - Intergenic
1073111003 10:101063014-101063036 CAGGCGGCAGATCTGGGAGTAGG - Exonic
1075047260 10:119155874-119155896 CACGCTCCAAATTTGGGTTTGGG - Intronic
1075956258 10:126525608-126525630 CACGCTGCACATCGGGGGTCTGG + Intronic
1076016700 10:127033505-127033527 CACTCTGCACAGCTGTGATACGG - Intronic
1077113302 11:871496-871518 CACACTGCACATTTGGGACCAGG + Intronic
1083141045 11:60722248-60722270 GAGGCTGGACAACTGGGATTTGG - Intergenic
1083194156 11:61072975-61072997 CATGCTCCCCATCTGGGAGTTGG + Intergenic
1083548273 11:63564985-63565007 CACTCTGAACAGCTTGGATTCGG - Intergenic
1083698055 11:64455800-64455822 CAAGTGGCACATCAGGGATTGGG + Intergenic
1083796275 11:65018574-65018596 CAAGCTGAACATCTGGGATGTGG + Exonic
1093086140 12:14868745-14868767 CACCCTGCAGACCTTGGATTGGG - Intronic
1096840190 12:54375258-54375280 GAGGCTGAACATCTGGGTTTTGG + Intronic
1108577901 13:51804782-51804804 CACACTGTTCATCTGGGCTTGGG - Intergenic
1110016718 13:70414735-70414757 CACTCTGTAGATCTGGGATAGGG - Intergenic
1111210881 13:85077820-85077842 CAGGTAGGACATCTGGGATTTGG - Intergenic
1114311837 14:21474866-21474888 CAAACTGCAAATCTGGGATACGG - Exonic
1119212525 14:72843235-72843257 GAGGCTGCACATCTAGGTTTTGG - Intronic
1131695161 15:94868776-94868798 GAGGCTGAACATCTGGGATGAGG + Intergenic
1132728987 16:1351515-1351537 CACGCTGGCCATGTGGGAGTTGG - Exonic
1132856806 16:2048691-2048713 CCCTCTGCAGACCTGGGATTTGG - Exonic
1133203277 16:4217786-4217808 CACTCAGCAAATTTGGGATTTGG - Intronic
1137237406 16:46626820-46626842 CAAGCTGCAGATCTGGGACACGG - Intergenic
1141166929 16:81667125-81667147 CACGGTGCTGTTCTGGGATTTGG + Intronic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1151551334 17:74824179-74824201 CACGCACCACAGCTGGGATGTGG - Intronic
1159674500 18:71265148-71265170 CCCGCTGGACATCTAGAATTGGG + Intergenic
1160888429 19:1363529-1363551 CACGCTGCCCCACTGGGGTTGGG + Intronic
1165350044 19:35270138-35270160 CACGGTGCACAACAGGGATCTGG - Intronic
1166045011 19:40224800-40224822 CACGCGGCACACCTGGGGTTGGG + Exonic
1166866643 19:45842446-45842468 CACACTGCTCACCTGCGATTTGG + Exonic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168475287 19:56670701-56670723 GACGCTGCACATGTGGGCTTTGG - Intronic
925104548 2:1279641-1279663 CACGCAGCACATCAGAGATGCGG - Intronic
926695370 2:15766906-15766928 AAGGCTGCCCATCTGGGATTTGG + Intergenic
927843925 2:26461723-26461745 CACCCTGCAGATCTGGGATGCGG - Exonic
931990320 2:67783568-67783590 CATTCTACACATCTGGAATTGGG + Intergenic
937255927 2:120555604-120555626 GACCCAGCACAGCTGGGATTTGG + Intergenic
944023658 2:195137570-195137592 CAATCATCACATCTGGGATTGGG + Intergenic
944466118 2:200001657-200001679 CACGCTCCAGCTCTGGGCTTAGG + Intronic
946136739 2:217653782-217653804 CATGCTGCAAATCTGGGTCTGGG + Intronic
948037954 2:234874415-234874437 CAGGCTGCACCTCTGGAATTGGG + Intergenic
948566978 2:238893675-238893697 CACACTGTATGTCTGGGATTCGG - Intronic
948724390 2:239922809-239922831 CACACTGCACACCTGTGATGGGG - Intronic
1172846454 20:37932348-37932370 CACGCTGCACACCAGGCATGGGG - Intronic
1176076743 20:63252047-63252069 CAAGCTGCACATCTCGGCTAAGG + Intronic
1180051686 21:45334610-45334632 CACACTGCACCTGTGGGACTCGG - Intergenic
1180822998 22:18844966-18844988 CACCCTGTGCATTTGGGATTTGG - Intergenic
1181189962 22:21131046-21131068 CACCCTGTGCATTTGGGATTTGG + Intergenic
1181209242 22:21279459-21279481 CACCCTGTGCATTTGGGATTTGG - Intergenic
1181502667 22:23326727-23326749 CACCCTGTGCATTTGGGATTTGG + Intergenic
1181653466 22:24275128-24275150 CACCCTGTGCATTTGGGATTTGG + Intronic
1182502544 22:30757890-30757912 CAAGCTGCACATGAGGGATCAGG - Intronic
1183245572 22:36690819-36690841 AAAGCTTGACATCTGGGATTAGG - Intronic
1184067251 22:42127839-42127861 CACGCTGCACATCCGGATGTAGG + Exonic
1184069974 22:42141531-42141553 CACGCTGCACATCCAGGTGTAGG + Intergenic
1184071725 22:42151141-42151163 CACGCTGCACATCCGGGCGTAGG + Intergenic
1184646047 22:45896028-45896050 CATGCTGCAGATCTGGCAATGGG + Intergenic
1184875986 22:47275862-47275884 CAAGCTGCAGATTTGGGGTTTGG + Intergenic
1203217703 22_KI270731v1_random:15984-16006 CACCCTGTGCATTTGGGATTTGG + Intergenic
1203273139 22_KI270734v1_random:70872-70894 CACCCTGTGCATTTGGGATTTGG - Intergenic
949572614 3:5308163-5308185 CACGCATCACTTCTGGGATCAGG + Intergenic
952457721 3:33489503-33489525 CACCCTGCCCATCCAGGATTTGG + Intergenic
952925345 3:38315943-38315965 CAAGCAGCAGAGCTGGGATTTGG + Intronic
955275402 3:57542380-57542402 AAGGTTGCACAGCTGGGATTTGG - Intronic
956095249 3:65709045-65709067 AAGCCTGCACATCTGGGCTTTGG + Intronic
956857347 3:73288165-73288187 CAGGATTCACATCTGAGATTTGG - Intergenic
957562552 3:81841736-81841758 CACACTTCACATATGGGAGTTGG + Intergenic
958973035 3:100634583-100634605 TACCCTGCCCATCTGTGATTAGG - Intronic
974400012 4:61391433-61391455 CAGGCTACACCTCTGGCATTAGG + Intronic
975958303 4:79869088-79869110 GAGGCTGGACATCTGAGATTAGG - Intergenic
985426131 4:189832414-189832436 CACACTGCACAGCTGACATTGGG + Intergenic
990680192 5:58233962-58233984 GAAGCTGGACATCTGTGATTGGG - Intergenic
994312422 5:98289936-98289958 CATGTTCCACATCTAGGATTCGG - Intergenic
996981148 5:129496630-129496652 AAAGCTGCACAGCTGTGATTTGG - Intronic
998186086 5:139981215-139981237 CAAGCTGCTCATTTGGGACTGGG + Intronic
1012978984 6:105810420-105810442 CACTCTGAACATCTGGTGTTTGG - Intergenic
1017765952 6:157607469-157607491 CATGCTGCACAACTGTGTTTGGG - Intronic
1017770710 6:157642399-157642421 GAGCCTGCACTTCTGGGATTAGG + Intronic
1018673879 6:166202379-166202401 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018673885 6:166202405-166202427 CACGCCTCACAGCTGGGACTGGG - Intergenic
1019418252 7:937116-937138 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418271 7:937170-937192 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418280 7:937197-937219 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418299 7:937251-937273 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418326 7:937332-937354 CACGCTGCACATCTGGGATTTGG + Intronic
1019418334 7:937359-937381 CACGCCGGGCCTCTGGGATTTGG + Intronic
1019418342 7:937386-937408 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418405 7:937575-937597 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418424 7:937629-937651 CACGCCCGACCTCTGGGATTTGG + Intronic
1019418472 7:937764-937786 CACGCTGCACATCTGGGATTTGG + Intronic
1021621368 7:22553673-22553695 CATGCCACACATCTGGGATGCGG - Intronic
1023869090 7:44253055-44253077 CACACTGCCCATCAGGGATGCGG + Intronic
1023986636 7:45100969-45100991 CAAGCTGCTCATCTGTGAATGGG + Intronic
1024750503 7:52459731-52459753 GGGGCTGGACATCTGGGATTTGG + Intergenic
1032570454 7:132990456-132990478 CAAGCTGCCCATCTTGGATGGGG - Intronic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1037506801 8:19538755-19538777 CACTCTGCACATCTGGGTCAAGG + Intronic
1038241518 8:25812579-25812601 CACTCTGTTCATCTGGGATTAGG - Intergenic
1044469675 8:92551749-92551771 CACACTGCACATATGATATTGGG + Intergenic
1046383209 8:113476512-113476534 CACACTGAAGATTTGGGATTTGG - Intergenic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1049579612 8:143405341-143405363 CAGGCTGCACACCTGGCATCAGG - Intergenic
1051874687 9:21779064-21779086 CACGTTGAACATCTGGTATTTGG - Intergenic
1057449494 9:95144116-95144138 CACGCAGCACATCTGGGGAGGGG + Intronic
1059023915 9:110604307-110604329 CACTCTGAACATCTGGGGTGGGG - Intergenic
1059348447 9:113648107-113648129 GAGGCTGCACTTCTGGGATGTGG - Intergenic
1059662557 9:116416412-116416434 CACTCAGCACATCTGTAATTGGG - Intergenic
1060149704 9:121280569-121280591 CATCCTGCACATGTGCGATTTGG - Intronic
1060294270 9:122332591-122332613 CACACTGGACATCTGGGTTGTGG - Intergenic
1060420108 9:123462389-123462411 CATGCTGCACACCTGGGTTTGGG - Intronic
1061916933 9:133760195-133760217 CAGCCTGCACATCTGGGAGAAGG + Intergenic
1062344829 9:136109837-136109859 CACGCTGCCCAGCTGGGCTGGGG + Intergenic
1186556471 X:10565382-10565404 AACGGACCACATCTGGGATTTGG - Intronic
1188433337 X:30132205-30132227 CACGCTCCACCTCCGGTATTGGG - Intergenic
1190931824 X:54955140-54955162 CAATCTGCACAACTGGGATATGG + Intronic
1195745720 X:108116016-108116038 TACGGTGCACATCAGGGATGAGG + Intronic
1199693226 X:150324977-150324999 CACCCTGCACATTTTGGACTTGG - Intergenic