ID: 1019421691

View in Genome Browser
Species Human (GRCh38)
Location 7:953930-953952
Sequence GCCTCACGCCCTTCCCGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019421691_1019421692 -6 Left 1019421691 7:953930-953952 CCGGTGCGGGAAGGGCGTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1019421692 7:953947-953969 TGAGGCATGACGTCACCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019421691_1019421694 3 Left 1019421691 7:953930-953952 CCGGTGCGGGAAGGGCGTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1019421694 7:953956-953978 ACGTCACCGCGAGGTGGCCCCGG No data
1019421691_1019421693 -3 Left 1019421691 7:953930-953952 CCGGTGCGGGAAGGGCGTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1019421693 7:953950-953972 GGCATGACGTCACCGCGAGGTGG 0: 1
1: 0
2: 0
3: 0
4: 38
1019421691_1019421697 12 Left 1019421691 7:953930-953952 CCGGTGCGGGAAGGGCGTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1019421697 7:953965-953987 CGAGGTGGCCCCGGAGCCGGCGG No data
1019421691_1019421696 9 Left 1019421691 7:953930-953952 CCGGTGCGGGAAGGGCGTGAGGC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1019421696 7:953962-953984 CCGCGAGGTGGCCCCGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019421691 Original CRISPR GCCTCACGCCCTTCCCGCAC CGG (reversed) Intronic
900199991 1:1400161-1400183 GTCTCACGCCCTGCCCGTCCTGG + Exonic
900292058 1:1927824-1927846 GGCTCCCGCGGTTCCCGCACTGG - Intronic
900707486 1:4089712-4089734 GCCTCCTGCACTTCCCCCACGGG + Intergenic
901188272 1:7388835-7388857 GCCTCAGGGCCTTCCAGCACTGG - Intronic
902044324 1:13513707-13513729 GGCGCACGCCCTCCCCGCCCGGG - Exonic
904355863 1:29939388-29939410 GCCTCACCCCCGTCCCACATTGG - Intergenic
905226626 1:36483036-36483058 GCCTCACCAGCTTCCCTCACAGG - Exonic
915640448 1:157220199-157220221 TCCCCAGGCCCTTCCCACACGGG - Intergenic
919911471 1:202113500-202113522 GCCTCACCCCATTCCTGCCCTGG + Intergenic
1063219162 10:3950387-3950409 GCCTCACTCCCCTCCTGTACAGG - Intergenic
1067797222 10:49329376-49329398 GCCTCACTCCCTTACAGCACTGG + Intergenic
1069942363 10:71964410-71964432 GCCTGGCGCCCTCCCCGCTCAGG - Exonic
1070827327 10:79398911-79398933 GCCTGCTGCCCTTCACGCACTGG - Intronic
1073011494 10:100363356-100363378 GCCTTCCTCCCTTCCAGCACTGG - Exonic
1076249402 10:128973381-128973403 TCCTCTCTCCCTTCCCTCACCGG - Intergenic
1076402491 10:130193140-130193162 TCCACATGCCCTTCCCGCCCAGG + Intergenic
1077103647 11:832870-832892 GCCTCAAGCCCCTCCCGCGGCGG - Exonic
1077352972 11:2101276-2101298 GACTCACCACCTTCCCTCACTGG + Intergenic
1077462006 11:2715421-2715443 GCCTCCCCCCATTCCCACACTGG - Intronic
1077705545 11:4481778-4481800 ATCTCACTCCCTTCCCACACAGG - Intergenic
1084275809 11:68050394-68050416 GCCTGAAGCCCTCCCTGCACGGG - Intronic
1089586489 11:119512859-119512881 GCCTCAGGCCCCTCTCCCACAGG - Intergenic
1092659303 12:10722288-10722310 CCCTGACGCCCTTCCCACATGGG - Intronic
1092843848 12:12566220-12566242 GCCCCACCTCCTTCCCGGACTGG - Intergenic
1103412995 12:120725910-120725932 GCCTCGGGCCCTGCCCGCAGAGG + Exonic
1103564905 12:121810626-121810648 TCGTCACGCCCCTCCAGCACCGG + Exonic
1105707414 13:22976893-22976915 GGCTCACACCCTCCCTGCACAGG - Intergenic
1106248028 13:27965178-27965200 GCCTCATACCCTCCCCCCACAGG - Intronic
1113567768 13:111328992-111329014 GCCCAACGCCCTTCACGCGCAGG - Intronic
1113885982 13:113658577-113658599 GCCTCACGCCCTCCCAGGCCAGG - Intergenic
1118330052 14:64807932-64807954 GACTCACCCCCTTCCTGCACTGG - Intronic
1121074856 14:91060017-91060039 GCTGCTCCCCCTTCCCGCACAGG - Intronic
1121650343 14:95553376-95553398 ACCCCACACCCTTCCCGCAGAGG - Intergenic
1121690780 14:95876198-95876220 GCCGCCGGCCCTCCCCGCACTGG + Intergenic
1122168881 14:99854146-99854168 GACACGCGCTCTTCCCGCACTGG - Intronic
1122904401 14:104795319-104795341 GCCCCGCGCCCTCCCCGCCCAGG + Intronic
1127710807 15:61596069-61596091 GCCTCACTTCCTTCCCTCTCTGG - Intergenic
1129250915 15:74308532-74308554 GTCTCAGCCCCTTCCCCCACAGG - Intronic
1130081485 15:80737802-80737824 GGCTCAGGCTCTTCCCTCACTGG - Intronic
1131425863 15:92345044-92345066 GCCTCACTCCCTTACTTCACTGG - Intergenic
1132458835 16:39348-39370 GCCTCACGGCCTGCCTGCCCTGG + Intergenic
1132768596 16:1548084-1548106 GCCTCTCGCTCTTCCCTCCCAGG + Intronic
1133030959 16:3010955-3010977 ACCTCCAGCCCTGCCCGCACTGG + Intergenic
1133116022 16:3578469-3578491 CCCTCACGCCCTTCCCTGTCAGG - Intergenic
1140312748 16:73865399-73865421 GCCTCATGCCCACCCCACACCGG - Intergenic
1141158687 16:81614340-81614362 GGCACACTCCCTTCCCCCACTGG - Intronic
1141663876 16:85455874-85455896 GCCTAATGCCCTTCCCTCCCAGG + Intergenic
1142172141 16:88628454-88628476 GCCTCTTGCCCTTCCAGCAGAGG - Intronic
1142194030 16:88731377-88731399 GCATCACGGCCGACCCGCACGGG + Intronic
1142825386 17:2507182-2507204 CCCTCACCTCCTTCCCGGACGGG - Intronic
1142983085 17:3682515-3682537 GCATCTCCCTCTTCCCGCACAGG - Intronic
1146693512 17:34892665-34892687 GCCTCCCTCTCTTCCCGCCCAGG + Intergenic
1147384776 17:40074632-40074654 GCCTCACGTCCATCCCACAGAGG - Intronic
1147754847 17:42761379-42761401 GCCTCTCGCGCCTCCCGCCCGGG - Intronic
1147907589 17:43833039-43833061 GCCTCCCGCCCCTCCCGCCGCGG + Intronic
1148646965 17:49224794-49224816 GCCGCACGCCCTGCTCGCCCAGG + Exonic
1148684711 17:49495089-49495111 GCCTCTCACCCATCCCGCCCTGG - Intergenic
1152354112 17:79798326-79798348 CCCTCTCGCCCAGCCCGCACTGG - Intronic
1152563249 17:81089123-81089145 TCCTCAAGCCCATCCCACACAGG + Intronic
1152962769 18:89597-89619 GCCTCACGGCCTGCCTGCCCTGG + Intergenic
1158976427 18:62715445-62715467 GACACACGCCCTCCCCGCCCGGG - Exonic
1160522033 18:79513310-79513332 GCCTCACGCCCTGGCCGCGGAGG - Intronic
1160680359 19:409239-409261 GCCCCACCCCCTTCCCGCGGGGG - Intergenic
1164804320 19:31104494-31104516 GCCTCCCGCCCTTCCTTCTCGGG - Intergenic
1165738970 19:38194428-38194450 GCCTCACGCCCCTCCAGGCCAGG - Intronic
1166043898 19:40218294-40218316 GCCTCCCGCCCTCTCCCCACCGG - Exonic
1168241670 19:55092009-55092031 CCCACAAGCCCTTCCCCCACGGG + Intronic
1168408230 19:56121522-56121544 GCCCCGCCCCCTTCCCGGACAGG + Intergenic
1168678301 19:58295008-58295030 GCCTGAAGCCCTTCCCGCAGTGG - Exonic
925296270 2:2779641-2779663 CCCTGACTCCCTTCCCACACTGG + Intergenic
926230819 2:11002630-11002652 TCCTCACTCCCTTTCTGCACAGG - Intergenic
926914588 2:17879428-17879450 GCCTCACGCCGTCCCCACCCAGG - Intronic
928904829 2:36357008-36357030 CCCTACCGCCCTCCCCGCACTGG + Intronic
937631697 2:124109231-124109253 GCCTCAAACCCTTGCCTCACAGG + Intronic
947846927 2:233251953-233251975 GCCCCACTCCCAGCCCGCACCGG - Intronic
948212975 2:236208610-236208632 TCCTCCCGCCCCTCCCCCACCGG + Intronic
1171217921 20:23365613-23365635 AACTCAGGCCCTTGCCGCACTGG - Exonic
1174202129 20:48814062-48814084 GCCTCCTGCCCTTACCACACTGG - Intronic
1175225049 20:57439738-57439760 GCCCCACCCCCATCCCGCTCAGG - Intergenic
1175908903 20:62395314-62395336 GCCGCCAGCCCTACCCGCACTGG - Intronic
1179486189 21:41712261-41712283 GCCTGCCGCCCTGCGCGCACCGG + Intergenic
1181212085 22:21294826-21294848 GCCTCCTGACCTTCCCGCAAAGG - Intergenic
1181397411 22:22632060-22632082 GCCTCCTGACCTTCCCGCAAAGG + Intergenic
1181500162 22:23311435-23311457 GCCTCCTGACCTTCCCGCAAAGG + Intronic
1181651996 22:24264002-24264024 GCCTCCTGACCTTCCCGCAAAGG - Intergenic
1181705381 22:24646741-24646763 GCCTCCTGACCTTCCCGCAAAGG + Intergenic
1181760050 22:25052068-25052090 GCCCCAGGCCCTTCCCGCCATGG + Intronic
1184301305 22:43562658-43562680 GCCTCCCTCCCATCCCCCACCGG - Intronic
1184301371 22:43562816-43562838 GCCTCCCTCCCATCCCCCACCGG - Intronic
1184301383 22:43562842-43562864 GCCTCCCTCCCATCCCCCACCGG - Intronic
1203275766 22_KI270734v1_random:84786-84808 GCCTCCTGACCTTCCCGCAAAGG - Intergenic
950362402 3:12458972-12458994 GCCTGGCTCCCTTCCCGCCCCGG - Intergenic
950544453 3:13630266-13630288 GCCACAGGCGCGTCCCGCACAGG - Intronic
954306028 3:49725888-49725910 GCCCCATGCCCTTCCTCCACAGG - Exonic
956601079 3:71023072-71023094 GCCTCCCTCCCTTCCCCCACTGG + Intronic
956603406 3:71047490-71047512 GCCTCCCTCCCTGCCTGCACCGG + Intronic
962313808 3:134345444-134345466 GCCTCAGGCCCTTCCCTTCCAGG - Intergenic
963001102 3:140682612-140682634 GCCGCAGGCACTTCTCGCACAGG - Exonic
967987225 3:195104438-195104460 GCCCCACCCCCTCCCCGCAAGGG - Intronic
968399401 4:279059-279081 CCCTCACGCGTTTCCCGCACAGG + Intronic
971001197 4:22324577-22324599 ACCTCAAGCCTTTCCCACACAGG + Intergenic
985261603 4:188119781-188119803 TCCTTACTCCCTTCCCTCACTGG + Intergenic
985525781 5:401010-401032 GCCTCACTCCCGCCCCACACGGG - Intronic
985542095 5:492071-492093 ACCTCCCTCCCTTCCCCCACAGG - Exonic
994245653 5:97472219-97472241 TCCCCACGCCCTTCCCACACTGG + Intergenic
1001382885 5:171315550-171315572 GCCTCACTCCCTGCCCGGACCGG - Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006320285 6:33315856-33315878 GCCTCAGGCCCTCCCCCCACTGG + Exonic
1006340202 6:33442669-33442691 GCCTCACCCCCTTCCCGGAGGGG + Intronic
1006475215 6:34248765-34248787 GCCTGACGCCCTCCCCACCCTGG - Intronic
1006845138 6:37056464-37056486 GCCCCACGCCCATCCCGGGCAGG - Intergenic
1008469322 6:51865589-51865611 GCCTCACTCCCTGCCCTCTCTGG + Intronic
1016207826 6:141491101-141491123 GCCTCACACCCTACCCACAAGGG - Intergenic
1019342016 7:512807-512829 GCCTCAGGCCCCTCCTGCCCCGG - Intronic
1019421691 7:953930-953952 GCCTCACGCCCTTCCCGCACCGG - Intronic
1023018053 7:35985367-35985389 GCATCAGGCCCTTCCCACAGGGG + Intergenic
1023319287 7:38976014-38976036 GGCTCACGCCATCCGCGCACCGG + Intergenic
1026824488 7:73572970-73572992 ACATCACTCCCTTCCCGCTCAGG - Exonic
1027235311 7:76294515-76294537 TCCTCCCGCCCCTCCCGCTCTGG - Intergenic
1030365146 7:108637338-108637360 GCCTCACTCCCACCCCACACTGG - Intergenic
1030797578 7:113807658-113807680 GCCTCATGCCTTTCCTTCACTGG + Intergenic
1031899322 7:127392408-127392430 GCCTCAGGTCCTGCCCGCTCCGG - Exonic
1032978076 7:137248635-137248657 GCCTCACTGCCCTCCAGCACGGG + Intronic
1034434152 7:151055184-151055206 GCCTCCCTCCCTTCCCCCAGAGG + Intronic
1034944710 7:155254367-155254389 GCCAAACGCCCTGCCCGCCCTGG + Intergenic
1039285923 8:36040844-36040866 GCCTCAGTCCCCTCCCACACAGG - Intergenic
1045356307 8:101392263-101392285 GCCTAAGGCCCTTCCCACAGGGG + Intergenic
1049711901 8:144068498-144068520 TCCCCACACTCTTCCCGCACAGG - Intergenic
1057448344 9:95134813-95134835 GCCTGGCTCCCTTCCCGCTCAGG - Intronic
1059427712 9:114231466-114231488 GCTGCACGCCCTTCCCACTCAGG - Intronic
1059681439 9:116590247-116590269 GGATCACCCCCTTCCCCCACAGG + Intronic
1062081264 9:134624908-134624930 GCCTCACACCCTAGCCCCACTGG - Intergenic
1062228235 9:135465863-135465885 GTCTCACACCCTTCCCTCACTGG + Intergenic
1062500440 9:136849775-136849797 GTGTCACGCCCTTCCCGCCCAGG - Intronic
1192362738 X:70449668-70449690 GCCTCTCGGGCTTCCCCCACAGG + Exonic
1198370589 X:135985470-135985492 GCCTCCCGCCCCTACCTCACCGG - Exonic