ID: 1019423870

View in Genome Browser
Species Human (GRCh38)
Location 7:964022-964044
Sequence CCCCCAGAGCCTGCCGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019423861_1019423870 7 Left 1019423861 7:963992-964014 CCCAGAGCCCGCTGAGGCGGGAA 0: 1
1: 0
2: 5
3: 8
4: 104
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423860_1019423870 8 Left 1019423860 7:963991-964013 CCCCAGAGCCCGCTGAGGCGGGA 0: 1
1: 0
2: 3
3: 22
4: 162
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423862_1019423870 6 Left 1019423862 7:963993-964015 CCAGAGCCCGCTGAGGCGGGAAA 0: 1
1: 0
2: 5
3: 7
4: 96
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423858_1019423870 9 Left 1019423858 7:963990-964012 CCCCCAGAGCCCGCTGAGGCGGG 0: 1
1: 0
2: 3
3: 10
4: 179
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423865_1019423870 -1 Left 1019423865 7:964000-964022 CCGCTGAGGCGGGAAACGGTTCC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423856_1019423870 10 Left 1019423856 7:963989-964011 CCCCCCAGAGCCCGCTGAGGCGG 0: 1
1: 0
2: 5
3: 25
4: 163
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423864_1019423870 0 Left 1019423864 7:963999-964021 CCCGCTGAGGCGGGAAACGGTTC 0: 1
1: 4
2: 0
3: 10
4: 63
Right 1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019423870 Original CRISPR CCCCCAGAGCCTGCCGAGGC GGG Intronic
No off target data available for this crispr