ID: 1019423882

View in Genome Browser
Species Human (GRCh38)
Location 7:964055-964077
Sequence CCCCCAGAGCCTGCCGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019423876_1019423882 -3 Left 1019423876 7:964035-964057 CCGAGGCGGGAAACGGTTCCCCC 0: 4
1: 0
2: 0
3: 8
4: 80
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423871_1019423882 9 Left 1019423871 7:964023-964045 CCCCAGAGCCTGCCGAGGCGGGA 0: 3
1: 1
2: 3
3: 21
4: 164
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423869_1019423882 10 Left 1019423869 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG 0: 3
1: 1
2: 4
3: 14
4: 200
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423872_1019423882 8 Left 1019423872 7:964024-964046 CCCAGAGCCTGCCGAGGCGGGAA 0: 4
1: 0
2: 2
3: 7
4: 109
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423873_1019423882 7 Left 1019423873 7:964025-964047 CCAGAGCCTGCCGAGGCGGGAAA 0: 3
1: 0
2: 1
3: 5
4: 117
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423867_1019423882 11 Left 1019423867 7:964021-964043 CCCCCCAGAGCCTGCCGAGGCGG 0: 3
1: 1
2: 4
3: 17
4: 215
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423875_1019423882 1 Left 1019423875 7:964031-964053 CCTGCCGAGGCGGGAAACGGTTC 0: 4
1: 1
2: 0
3: 3
4: 38
Right 1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019423882 Original CRISPR CCCCCAGAGCCTGCCGAGGC GGG Intronic
No off target data available for this crispr