ID: 1019423905

View in Genome Browser
Species Human (GRCh38)
Location 7:964121-964143
Sequence CCCCCAGAGCCTGCCGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019423890_1019423905 12 Left 1019423890 7:964086-964108 CCCCCCAAGAGCCTGCCGAGGCG 0: 1
1: 2
2: 0
3: 6
4: 107
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423899_1019423905 -3 Left 1019423899 7:964101-964123 CCGAGGCGGGAAACGGTTCCCCC 0: 4
1: 0
2: 0
3: 8
4: 80
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423895_1019423905 9 Left 1019423895 7:964089-964111 CCCAAGAGCCTGCCGAGGCGGGA 0: 1
1: 3
2: 1
3: 7
4: 86
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423896_1019423905 8 Left 1019423896 7:964090-964112 CCAAGAGCCTGCCGAGGCGGGAA 0: 4
1: 0
2: 2
3: 7
4: 109
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423898_1019423905 1 Left 1019423898 7:964097-964119 CCTGCCGAGGCGGGAAACGGTTC 0: 4
1: 1
2: 0
3: 3
4: 38
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423893_1019423905 10 Left 1019423893 7:964088-964110 CCCCAAGAGCCTGCCGAGGCGGG 0: 1
1: 3
2: 0
3: 11
4: 92
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423891_1019423905 11 Left 1019423891 7:964087-964109 CCCCCAAGAGCCTGCCGAGGCGG 0: 1
1: 3
2: 1
3: 13
4: 105
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data
1019423888_1019423905 30 Left 1019423888 7:964068-964090 CCGAGGCGGGAAACGGTTCCCCC 0: 4
1: 0
2: 0
3: 8
4: 80
Right 1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019423905 Original CRISPR CCCCCAGAGCCTGCCGAGGC GGG Intronic
No off target data available for this crispr