ID: 1019427474

View in Genome Browser
Species Human (GRCh38)
Location 7:984341-984363
Sequence CCCCTTAGGTCCCCTCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019427474_1019427482 -7 Left 1019427474 7:984341-984363 CCGGCCTGAGGGGACCTAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1019427482 7:984357-984379 TAAGGGGGGTCTTGTGGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 255
1019427474_1019427484 2 Left 1019427474 7:984341-984363 CCGGCCTGAGGGGACCTAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1019427484 7:984366-984388 TCTTGTGGGTGAGGGCTGCCCGG 0: 1
1: 0
2: 0
3: 21
4: 208
1019427474_1019427485 3 Left 1019427474 7:984341-984363 CCGGCCTGAGGGGACCTAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1019427485 7:984367-984389 CTTGTGGGTGAGGGCTGCCCGGG 0: 1
1: 0
2: 0
3: 30
4: 249
1019427474_1019427483 -6 Left 1019427474 7:984341-984363 CCGGCCTGAGGGGACCTAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 116
Right 1019427483 7:984358-984380 AAGGGGGGTCTTGTGGGTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019427474 Original CRISPR CCCCTTAGGTCCCCTCAGGC CGG (reversed) Intronic
900270965 1:1788438-1788460 CCACTCTGGTCCCCCCAGGCTGG + Intronic
903698977 1:25232279-25232301 CCCCGCCGGTCCCCACAGGCTGG + Intronic
904336925 1:29803828-29803850 CCCCTTGGGTCCCCAGAGACAGG + Intergenic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
906859446 1:49343170-49343192 CACCTTAGGTCCTCTCATGTGGG - Intronic
919762133 1:201104798-201104820 CCACATTGGTCCCCTCAGCCTGG + Intronic
920225416 1:204434937-204434959 CTCTTAAGGTCCCCTCAGTCTGG - Intronic
920455842 1:206100491-206100513 ACCCTCAGGTCCCCACAGGCAGG - Intronic
924944802 1:248838823-248838845 CCCCTTAAGTCGGCTCAGCCTGG - Intronic
1065236550 10:23658246-23658268 CCCTTTGGGTTCCCCCAGGCAGG + Intergenic
1067217592 10:44315968-44315990 CCCCTGGGGCTCCCTCAGGCAGG + Intergenic
1068700008 10:60009745-60009767 ACCCTTAGGACCCCTTAGGCAGG - Intergenic
1072565515 10:96613758-96613780 CAGCTGAGGTCCTCTCAGGCAGG - Intronic
1073484289 10:103806829-103806851 GCCCCTGGGTCCCCTCAGTCTGG - Intronic
1076878749 10:133230111-133230133 CCCCTTAGGACCCGGCGGGCGGG + Intergenic
1083766142 11:64842473-64842495 CCACGTGGGGCCCCTCAGGCTGG + Intronic
1084685348 11:70691184-70691206 CCCCTTAGCACCCCACAGTCCGG - Intronic
1084760912 11:71270320-71270342 CCCCTTAGGTGCCCCCAGTCCGG + Intergenic
1084978301 11:72815092-72815114 CCCCTGATGCCCCCTCAGGCTGG - Intronic
1089633688 11:119798855-119798877 CTCCTGTGGTCACCTCAGGCTGG + Intergenic
1090604176 11:128404424-128404446 CCTCTCAGCTCCCCTAAGGCGGG - Intergenic
1091284217 11:134399111-134399133 CCCCTTTGCTCCCATCATGCAGG - Intronic
1091870619 12:3887776-3887798 CACCATAGTTTCCCTCAGGCTGG + Intergenic
1092538458 12:9405946-9405968 GCTCTTAGGTCCCCTAACGCGGG + Intergenic
1096243675 12:49972888-49972910 CCCATCAGGTCAGCTCAGGCTGG + Intronic
1096914535 12:55017399-55017421 CCGCTTAGGGGCCCACAGGCAGG + Intergenic
1104492201 12:129203845-129203867 TCCATGAGGCCCCCTCAGGCAGG - Intronic
1104891540 12:132142569-132142591 CCACTTGGGTCTCCTGAGGCTGG - Intronic
1109653184 13:65354330-65354352 CCACTTGAGTCCTCTCAGGCAGG - Intergenic
1116972605 14:51082119-51082141 GCCCCCAGGTCCCCTCAGGATGG - Intronic
1117273146 14:54165674-54165696 CCCCTTCTGTCTCCTCAGACAGG + Intergenic
1122102009 14:99420235-99420257 CCCCTCCAGTCCCCACAGGCAGG + Intronic
1122291398 14:100682145-100682167 CGCCAAAGGTCCCCACAGGCAGG + Intergenic
1123183321 14:106489936-106489958 CCCCTGAGCTCTCCTCAGACAGG + Intergenic
1125726348 15:41870188-41870210 CCCCTGCAGCCCCCTCAGGCTGG - Intronic
1130042840 15:80419288-80419310 CCCTTCAGGTCCACTGAGGCAGG + Intronic
1131972513 15:97906468-97906490 CCCCATATGTCCCTTCAGCCAGG - Intergenic
1132483533 16:178162-178184 CCACTCAGCTCCCCTGAGGCTGG + Intergenic
1136269203 16:29138559-29138581 CCCCTTTGCTCCCCTGAAGCAGG - Intergenic
1138350412 16:56343613-56343635 CCCCTCAGGTCCCCTCCATCAGG + Intronic
1138465243 16:57185639-57185661 ACCCTCAGCTCCCCTCAGGCTGG + Intronic
1140176391 16:72664732-72664754 CTGCTTAGCTCCCCTGAGGCAGG - Intergenic
1141882509 16:86869336-86869358 CCCCTCAGCTCCTCTCAGCCTGG - Intergenic
1142283008 16:89159387-89159409 GCCCGTAGGTCCCCACAGGCGGG + Intergenic
1143485758 17:7252642-7252664 CCACTTCCGTCCCCTCAGCCAGG - Intronic
1143754127 17:9054109-9054131 GCCCTTCGTTCCCATCAGGCTGG - Intronic
1146303459 17:31709934-31709956 CCCCTCAGGGCCCAGCAGGCCGG + Intergenic
1147961209 17:44168711-44168733 CCCCTTGGCTCTCCTCAGGCCGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1151425384 17:74027832-74027854 CCCTTTAGCTCCCCACAGGCTGG - Intergenic
1152088300 17:78233327-78233349 CCCCTCAGAGTCCCTCAGGCAGG - Intronic
1152311649 17:79554988-79555010 CCTCTTTGTTCCCCTCAGGCTGG - Intergenic
1156481564 18:37439713-37439735 CCAATTGAGTCCCCTCAGGCCGG + Intronic
1161153410 19:2720995-2721017 CCGCATTGGTCCCCTCGGGCAGG - Intronic
1161702909 19:5804936-5804958 CTCCTCCGGTCCCCTCCGGCGGG + Intergenic
1161733719 19:5977891-5977913 CCTATTGCGTCCCCTCAGGCCGG - Intronic
1161847030 19:6718068-6718090 CCCCTGGGGCCCCCTCTGGCTGG + Intronic
1162967861 19:14164485-14164507 CCCCTGAGGGACCCTCAGTCGGG - Intronic
1163684111 19:18700957-18700979 TCCCTTCGGTCCTCCCAGGCAGG + Intronic
1165378070 19:35457606-35457628 CCCTTCAGGTCCCTTCAGGTAGG + Intergenic
1165946456 19:39445767-39445789 CCCCTTAGGGCGCTTCCGGCAGG - Intronic
1166329390 19:42069646-42069668 CCCCTGTGGCCCCCCCAGGCCGG - Intronic
1166414616 19:42585266-42585288 CTCCTTAGGTCAGCCCAGGCTGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926115344 2:10209718-10209740 CCCCTTAGGTCTCCACGGACGGG - Intronic
927514388 2:23663338-23663360 GCCCTTGGGTCCCCGCGGGCTGG + Intronic
937623988 2:124023785-124023807 CTCCTTAGGTCACCTCAGCCTGG + Intergenic
938389502 2:130893774-130893796 CTCCTTAGGCCCCTTCTGGCTGG - Intronic
938412240 2:131074806-131074828 TCCCTTCGGCCCCCTCAGCCTGG + Intronic
941170072 2:162125465-162125487 CCTCTTAGGACCCCTAAGACTGG + Intergenic
948847551 2:240690422-240690444 CCTCCTATGTGCCCTCAGGCAGG + Intergenic
1168830389 20:842262-842284 GCCCTGAGGTCCCCTCTGGCGGG - Intronic
1173182535 20:40815785-40815807 CCCCCTACTTCCCCCCAGGCAGG + Intergenic
1173595753 20:44257696-44257718 CCCTCTAGGTCCCCACAGACAGG + Intronic
1175656610 20:60776400-60776422 CCCCGTAGGTCCCATCCGACGGG - Intergenic
1175855508 20:62118812-62118834 CTCCTCAGCTCCCTTCAGGCTGG + Intergenic
1178795399 21:35739351-35739373 CCCCTTTTCTCCCCTGAGGCGGG - Intronic
1178916025 21:36705991-36706013 TCCCTTAGGTGCCCTCATGAAGG + Intronic
1179545171 21:42108730-42108752 CACCTTCATTCCCCTCAGGCGGG + Intronic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1183062473 22:35344638-35344660 CACCTGAGGACCCCCCAGGCAGG - Intronic
1183541019 22:38429518-38429540 CCCCGTAGGTCCCATGAGGTAGG - Intronic
1184654255 22:45933203-45933225 CCCCTTAGTTCTTCTCAGGAAGG - Intronic
1184724983 22:46338860-46338882 CCCCTAAAGCCCACTCAGGCAGG - Intronic
1185100176 22:48836127-48836149 CCCCACAGGTCCCCCCACGCTGG - Intronic
954411919 3:50374593-50374615 ACCCTCAGGTGCCCGCAGGCTGG - Intronic
956418468 3:69059533-69059555 TTCCTTGGATCCCCTCAGGCTGG - Intronic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
971707723 4:30068475-30068497 GCCCTTAGCTCCCCTCTTGCTGG + Intergenic
972804898 4:42519288-42519310 CCCCCTATGTTCCCCCAGGCTGG + Intronic
973907448 4:55546311-55546333 CCCCAGAGGGCCTCTCAGGCAGG + Intronic
975820524 4:78266404-78266426 CCCGTGAGGTCCCCTCCGGTTGG + Intronic
983795645 4:171859428-171859450 CCCCTTGAGTCCCTTCAGGAAGG + Intronic
984864862 4:184272704-184272726 TCCCCTTGGTCCCCTAAGGCAGG + Intergenic
985275326 4:188232867-188232889 CTCCTTGGCTCCCCTCACGCAGG - Intergenic
985421114 4:189786089-189786111 CCATCTAGGTCCCCCCAGGCAGG - Intergenic
986667105 5:10113699-10113721 TCCCTGAGGTCACCTCGGGCTGG + Intergenic
996341686 5:122445472-122445494 GACCTTGGTTCCCCTCAGGCAGG - Intronic
997517522 5:134501572-134501594 TCTCTTTGGTCCGCTCAGGCAGG - Intergenic
998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG + Intronic
1001991024 5:176115448-176115470 CCCCTGAGCTCCCCACAGTCAGG - Intronic
1002602962 5:180364561-180364583 CCCTTTATGTCAGCTCAGGCTGG - Intergenic
1015901620 6:138074094-138074116 CCTCTGAGGTCACCTCAGCCTGG - Intergenic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1019322270 7:421099-421121 GCCCTTAGGTCCCTGCAGGCAGG - Intergenic
1019427474 7:984341-984363 CCCCTTAGGTCCCCTCAGGCCGG - Intronic
1027128075 7:75571379-75571401 CCTCTCAGCTCCCTTCAGGCAGG + Intronic
1029486759 7:100847695-100847717 CTCCTGTGGTCCTCTCAGGCCGG - Intronic
1032090775 7:128910518-128910540 CCCTCTCGGCCCCCTCAGGCCGG + Intronic
1034188195 7:149195387-149195409 CCCGGTAGGTCCCCGCAGGCGGG + Intergenic
1037210209 8:16376908-16376930 CCGCCAGGGTCCCCTCAGGCTGG + Intronic
1037950294 8:23015062-23015084 CCCCTTAAATGACCTCAGGCAGG - Intronic
1047903642 8:129449917-129449939 CCCACTAGGCCCCCACAGGCAGG + Intergenic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1049415131 8:142491600-142491622 ACACTGAGGACCCCTCAGGCCGG - Intronic
1049861260 8:144901082-144901104 CCCCTTGGGCCCCGTCAGACCGG - Intronic
1052865988 9:33464962-33464984 CCCTTTAGTTCCCCCCAGGTTGG - Exonic
1055870784 9:80876787-80876809 CTCCTTATGTCCACTCAGACGGG - Intergenic
1057317189 9:93977088-93977110 CACCTGAGATCCCCTCAGCCTGG - Intergenic
1059652300 9:116326167-116326189 TCACTTAGGTCCTCTCAGGTTGG - Intronic
1061084212 9:128389851-128389873 CCCCTAAGCTCCCTCCAGGCAGG + Exonic
1061290386 9:129647416-129647438 CCCTTGAGGTCCCCTCAACCTGG + Intergenic
1062009504 9:134259376-134259398 CACCTTTGGTCCCATCAGCCGGG - Intergenic
1062365443 9:136206000-136206022 CCTCTGAGGTGCCCTCAGGCTGG + Intergenic
1062469382 9:136695877-136695899 CCCCACACGTCCCCCCAGGCAGG + Intergenic
1186750852 X:12619940-12619962 CACCCTGTGTCCCCTCAGGCAGG + Intronic
1187331229 X:18341473-18341495 ACCCATAGGGACCCTCAGGCTGG - Intronic
1192207039 X:69103159-69103181 CCCCCTTTGTCCCCTCATGCTGG - Intergenic
1198314460 X:135452151-135452173 TCCCCCAGGTCCCCCCAGGCTGG + Intergenic
1199529430 X:148830257-148830279 CCTACTAGGCCCCCTCAGGCAGG - Intronic
1201160169 Y:11159810-11159832 CAGCTAGGGTCCCCTCAGGCTGG + Intergenic
1201859142 Y:18575248-18575270 CCCCTTAGGTTCCATCGTGCTGG + Intronic
1201874180 Y:18745133-18745155 CCCCTTAGGTTCCATCGTGCTGG - Intronic