ID: 1019427702

View in Genome Browser
Species Human (GRCh38)
Location 7:985157-985179
Sequence CGGGAAGGGCCGGCCTGCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019427702_1019427708 -9 Left 1019427702 7:985157-985179 CCCTCGCAGGCCGGCCCTTCCCG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1019427708 7:985171-985193 CCCTTCCCGCTGGCCCTACTGGG 0: 1
1: 0
2: 0
3: 11
4: 155
1019427702_1019427719 30 Left 1019427702 7:985157-985179 CCCTCGCAGGCCGGCCCTTCCCG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1019427719 7:985210-985232 ATCACCTTCGCGCTCCTCTTCGG 0: 1
1: 0
2: 0
3: 6
4: 49
1019427702_1019427710 -5 Left 1019427702 7:985157-985179 CCCTCGCAGGCCGGCCCTTCCCG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1019427710 7:985175-985197 TCCCGCTGGCCCTACTGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 138
1019427702_1019427706 -10 Left 1019427702 7:985157-985179 CCCTCGCAGGCCGGCCCTTCCCG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1019427706 7:985170-985192 GCCCTTCCCGCTGGCCCTACTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1019427702_1019427712 -4 Left 1019427702 7:985157-985179 CCCTCGCAGGCCGGCCCTTCCCG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1019427712 7:985176-985198 CCCGCTGGCCCTACTGGGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019427702 Original CRISPR CGGGAAGGGCCGGCCTGCGA GGG (reversed) Exonic
900115180 1:1025224-1025246 TGGGCAGGGCCGGGCTGGGAAGG - Intronic
900296664 1:1955365-1955387 CTGGAGGGGCCGGGCTGCGGGGG - Intronic
900410649 1:2511022-2511044 CGGGACGGGCCAGCCTGCAGGGG + Intronic
900654241 1:3747185-3747207 CGGGCAGGGCCGGCCCGCCTGGG + Intergenic
900682579 1:3924991-3925013 CGGGAAGGGAGGGACTGCCAAGG - Intergenic
900977523 1:6026644-6026666 AGTGAAGGGCCGGGCTGCGTTGG - Intronic
901417629 1:9128588-9128610 CGGGAGGGGTCGGCCTGTGTCGG + Intronic
902435131 1:16393493-16393515 CTGGCAGGGCCGGCCAGTGATGG + Intronic
902623309 1:17662832-17662854 GGGGAAGGGTCTGCCTGTGATGG + Intronic
904915907 1:33970598-33970620 GGGGAAGGCCCGGGCTGGGAAGG - Intronic
905399566 1:37691844-37691866 CGGGAGTGGCCGGCCCGCGGGGG + Intronic
907046589 1:51303472-51303494 CGGGCTTGGCCGCCCTGCGATGG + Intronic
1063417955 10:5889360-5889382 CGGGTCGGGCCGGGCTGCGCGGG + Exonic
1065771507 10:29082596-29082618 TGGGCAGGCCCTGCCTGCGAGGG - Intergenic
1067837050 10:49648021-49648043 CGGGAGGGGAGGGCCTGCAAAGG + Intronic
1072809214 10:98446510-98446532 GGGGCAGGGCCGGGCTCCGAAGG - Intronic
1075319442 10:121478246-121478268 CAGGAAGGGCAGGGCTGCCAAGG - Intergenic
1077187249 11:1240842-1240864 CGGGAGGGCCGGGCCTGCAAGGG - Exonic
1077385847 11:2269187-2269209 CGGGCAGGGCCGGCCCGGGCGGG - Intronic
1081869237 11:46375824-46375846 CGGGCAGGGCCGGCAAGCGGGGG - Intronic
1083198693 11:61106391-61106413 GGGGAAGGACAGGCCTGAGAGGG + Intronic
1084013228 11:66364146-66364168 TGGGAAGGGACCGCCTGCAATGG - Intronic
1084431806 11:69115500-69115522 TGGGAAGGTCAGGCCTCCGAAGG - Intergenic
1085280779 11:75328922-75328944 CGGGAACGGCTGGGCTGAGAGGG + Intronic
1090362316 11:126182212-126182234 CGGGGAGGGACAGCCTGGGAGGG - Intergenic
1091831389 12:3553230-3553252 CTGGAAGGGCTGGGCTGCGGTGG + Intronic
1096466243 12:51848818-51848840 AGGGGAGGGAGGGCCTGCGAGGG - Intergenic
1103563625 12:121804780-121804802 CCCGAAGGGCCGGGCTGCGGCGG - Exonic
1104628324 12:130377853-130377875 TGGGAAGGGTTGGCCTCCGATGG - Intergenic
1104804288 12:131575233-131575255 CGAGCAGGGCCAGCCTGCGCTGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1114696603 14:24632248-24632270 AGGGAAGGGCCGGCATTCCAGGG + Intronic
1117252889 14:53953550-53953572 CTGGAGGGGCGGGCCCGCGAGGG - Intronic
1122945710 14:105007953-105007975 CGGAAAGGGCCGGGCTGGGGTGG - Intronic
1123002159 14:105301337-105301359 CGTGGAGAGACGGCCTGCGAAGG + Exonic
1123460657 15:20467154-20467176 CGGGAAGGGACGGGATGGGACGG + Intergenic
1123657404 15:22533262-22533284 CGGGAAGGGACGGGATGGGACGG - Intergenic
1124311316 15:28628471-28628493 CGGGAAGGGACGGGATGGGACGG - Intergenic
1126348255 15:47718415-47718437 CGGGTAGTGCCTGCCGGCGAGGG + Intronic
1127922488 15:63504456-63504478 GGGGAGGGGCCGGCCTGGAAAGG + Intergenic
1128482679 15:68054031-68054053 CGGGAAGGGCCGGAGCGAGAGGG - Intergenic
1129033837 15:72638017-72638039 CAAGAAGGGCTGGCCTGCCAGGG + Intergenic
1129216044 15:74099199-74099221 CAAGAAGGGCTGGCCTGCCAGGG - Intergenic
1132155444 15:99492590-99492612 CTGGAAGGTCAGGCCTGCCAGGG + Intergenic
1132572931 16:651840-651862 CGGGAAGGGCCTGGGTGCCAAGG - Exonic
1132655401 16:1039864-1039886 CCGCAAGGTCCAGCCTGCGAGGG - Intergenic
1132983200 16:2749727-2749749 CGGGAAGGACCAGCCTTGGAAGG + Intergenic
1138584318 16:57960442-57960464 CGGGAGGGGGCTGCCTGGGATGG - Intronic
1141806556 16:86345651-86345673 GGGGAGGGGCCGGCCAGCCAGGG - Intergenic
1142187115 16:88699773-88699795 CTGGAAGGGCCGTCCTGGGGAGG + Intronic
1142223888 16:88868063-88868085 GAGGAAGGGCCGCCCTGCGTGGG - Intergenic
1142355610 16:89600207-89600229 TGGGCAGGGCCTGCCTGGGAAGG + Intergenic
1142519840 17:497160-497182 CGGGAAGGGACGGAGAGCGAGGG + Intergenic
1144726811 17:17506363-17506385 CAGGAAGGGCCAGCCTGGGCAGG - Intronic
1147325607 17:39668103-39668125 TGGGAGGGGCCGGCCGGCGGGGG + Intronic
1147967005 17:44199261-44199283 GGGGCAGGGCCGGCCGGGGAGGG - Intronic
1150821228 17:68435973-68435995 CGTGCAGGGCGCGCCTGCGACGG - Intronic
1151624920 17:75270745-75270767 CGGATGGGGCCGGCCTGCGTGGG + Intronic
1152546770 17:81004193-81004215 CGGGAAGGGCTGGGCTGGGCTGG - Intronic
1152852919 17:82648229-82648251 CGGGAAGGCCCGGCCGGGCAAGG + Intronic
1153489300 18:5630683-5630705 CGGGGAGGGCGGGCCCGCGAGGG - Intronic
1154266107 18:12880588-12880610 AGGTAAGGGCCAGCCTGAGAGGG - Intronic
1158427704 18:57353685-57353707 CGCGCTGGGCCGGCCTGTGAAGG + Intronic
1159011319 18:63061586-63061608 TGAGAAGGGCCAGCCTGGGAAGG - Intergenic
1160453332 18:78979732-78979754 CGGGAGGGGCCGCCCGGCGGCGG + Intergenic
1160857458 19:1223954-1223976 GGGCAGGGGCCGGCCTGAGAAGG + Intronic
1162021860 19:7871736-7871758 GGGGAAGGACTGGCCTGCGGAGG + Exonic
1162154919 19:8671173-8671195 GGGGTGGGGCTGGCCTGCGATGG + Intergenic
1164541918 19:29127892-29127914 CAGGCAGGGCGGGCCTGCGGAGG + Intergenic
1166366736 19:42281697-42281719 CGGGAAGGGCCCCCCTGCCCTGG - Intronic
928928060 2:36598166-36598188 CGGGCTGGGCCGGCCTGGGCGGG - Exonic
929933433 2:46276205-46276227 CTGGCAGGGCCGCCCTGCGGAGG + Intergenic
933876015 2:86623013-86623035 CGGGGATGGCCGGCCAGTGACGG - Exonic
935191968 2:100785237-100785259 AGGGCAGACCCGGCCTGCGATGG - Intergenic
937223182 2:120353632-120353654 CAGGAAGGGCCTGCCTGAGCCGG + Intergenic
938368795 2:130756155-130756177 CGGGAGGGGCGGGCCGGCGCTGG - Intronic
942459022 2:176157084-176157106 CGGGAAGCGCCGTCCGCCGAGGG - Intronic
942565749 2:177264121-177264143 CCGGAAGGGCCGGGCCGCGCCGG + Intronic
944495799 2:200306636-200306658 CGGGCGGGGGCAGCCTGCGAGGG + Intronic
947641648 2:231710490-231710512 CGGGGCGGGCCGGACTGAGAGGG + Intronic
948505962 2:238427098-238427120 CGGGCAGGGCCGGGCTCCGCAGG + Exonic
1168765838 20:381216-381238 CGGGAGGGGGCGGCCGGGGAAGG + Intronic
1168766067 20:382015-382037 CGGGAGGGGCCTGGCTGCGGGGG + Intronic
1172042013 20:32052509-32052531 CGGGAATACCCGGCCCGCGAGGG + Intronic
1173548651 20:43916950-43916972 CGGGAAGGGCCCGTCAGGGAGGG + Intronic
1179225080 21:39445804-39445826 TGGGAAGCGCCGGCCTGCGGGGG + Intronic
1181026877 22:20131886-20131908 CGGGCAGGGCCGGCCGGGGTCGG - Intronic
1182222915 22:28772926-28772948 CGGGAAGGCCCGGCCGGGGAAGG - Exonic
1183577384 22:38700709-38700731 GGCGAAGGGCTGGCCCGCGAGGG + Intronic
1183619982 22:38966588-38966610 CTGGAAGGGCAGGCCTGTGGGGG + Intronic
1183668793 22:39260051-39260073 AGGGAAGGACCTGCCTGGGAAGG - Intergenic
949474830 3:4433535-4433557 CGGGAAGGGCAGGCCAGGGCTGG - Intronic
954004065 3:47578411-47578433 CGGGAAAGGCCGACCCGCGTGGG - Intronic
955386709 3:58486574-58486596 AGGGAAGGGCATGCCTGAGAGGG + Intergenic
956205957 3:66754892-66754914 AGGAAAAGGCTGGCCTGCGACGG - Intergenic
961439654 3:126945287-126945309 CTGGAAGGGCAGGCCTGTGGGGG + Intronic
961635134 3:128328480-128328502 CTGGAAGGGCAGGCATGCAATGG - Intronic
966708184 3:182940654-182940676 GGGAAAGGGCCTGCCTGCTATGG + Exonic
968425537 4:520543-520565 CGGGAAGGGCCAGTCTGCACTGG + Intronic
968803245 4:2756437-2756459 GGGGAAGGGCGGGGCTGCGCGGG - Intergenic
969684602 4:8664117-8664139 GGAGAGGGGCCGGCCTTCGAGGG + Intergenic
985671890 5:1210988-1211010 CTGGAAGGGCCGGGGTGGGAGGG - Intronic
997206853 5:132055236-132055258 GGGGAAGGGCCGGCCTGGGTGGG - Intergenic
997355093 5:133257422-133257444 CAGGAGGGGCCGGCCTGTGCAGG + Intronic
997734431 5:136203006-136203028 AGGGAAAGGCCGGCCCGCGAGGG + Intergenic
1006922733 6:37637251-37637273 GGGGCAGGGCCGGCCCGCCAGGG - Exonic
1010378949 6:75205385-75205407 CGGGGAGGGCAGGCGTGCGGCGG - Intronic
1012998352 6:105995015-105995037 CGGGAAGTGCGCGGCTGCGACGG - Intergenic
1019427702 7:985157-985179 CGGGAAGGGCCGGCCTGCGAGGG - Exonic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1021959511 7:25858119-25858141 CGGGAAGGGCCAGTCTCCGAGGG + Intergenic
1025015906 7:55439006-55439028 CTGGGAGGGCCGGGCTGAGATGG + Intronic
1028110259 7:86932204-86932226 CGGAAAGGGCTTGCCTGAGAAGG + Intronic
1033145736 7:138868900-138868922 GGGGCAGGGCCGGCCTGCGACGG + Intronic
1033595371 7:142855034-142855056 CGGGCCGGGCCGGCTTGGGAGGG + Intergenic
1034259397 7:149745355-149745377 AGGGAAGGGCCGGGCTGGGTGGG + Intergenic
1034451169 7:151138113-151138135 CGGGAAGGGTCAGACTGGGAAGG - Intronic
1035582311 8:747810-747832 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1035582356 8:747930-747952 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1035582372 8:747970-747992 TGGGATGGGCGGGCCTGCGGTGG + Intergenic
1039984574 8:42436718-42436740 AGGGAAGGGCTGGCCGGTGACGG - Intronic
1040559969 8:48515060-48515082 CGGGAGGGGCTGGCCTCCGCGGG - Intergenic
1043524215 8:81079062-81079084 CTGGAAGGGGAGGCCTGCAAAGG - Intronic
1045062615 8:98422676-98422698 AGGGCAGGGCCTGCCTGCGGTGG - Intronic
1050209571 9:3238380-3238402 TGAGAAGGGCTGGCCTGAGAAGG + Intronic
1054835627 9:69672442-69672464 GGGGCCGGGCGGGCCTGCGAGGG + Intergenic
1056559042 9:87713876-87713898 CAGGAAGGGCCAGCCTCAGAAGG - Intergenic
1057213940 9:93218040-93218062 GGGGAAGGGCCTGCCTTCGAGGG + Intronic
1060301137 9:122375227-122375249 CTGGATGGGCCGGACTGGGAGGG + Intronic
1061293924 9:129666905-129666927 GGGGATGGGCCGGCCTGCTGGGG + Intronic
1062020837 9:134318698-134318720 CGCGAAGGGCTGGCCTGGGCTGG + Intronic
1062209719 9:135357024-135357046 CGGGCAGGGCTGGGCTGGGATGG - Intergenic
1062424581 9:136500197-136500219 AGGGAGGGGCGGGGCTGCGAGGG + Intronic
1062690156 9:137837511-137837533 CGGGGAGTGCAGGCCTGGGAAGG + Intronic
1189354460 X:40300371-40300393 CCTGAAGGGCCGGCCTTTGAGGG - Intergenic
1191896195 X:65995876-65995898 CAGGAAGGGCAGGCCTAAGAAGG + Intergenic
1195285246 X:103376939-103376961 CGGAAAGGGCCGGGCGGCGGCGG + Intronic
1199687477 X:150277265-150277287 AGGCAAAGGGCGGCCTGCGAGGG + Intergenic
1199987691 X:152964256-152964278 CGTGAAGGCCGGGCCTGTGAGGG + Intronic
1201178422 Y:11323314-11323336 GGGCACGGGCGGGCCTGCGACGG - Intergenic