ID: 1019429151

View in Genome Browser
Species Human (GRCh38)
Location 7:990814-990836
Sequence ACACTGGGCGGGGCGTCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019429151_1019429167 25 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429167 7:990862-990884 GGAGGGTGCGGAACATTCCAGGG No data
1019429151_1019429169 30 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429169 7:990867-990889 GTGCGGAACATTCCAGGGCAGGG No data
1019429151_1019429160 7 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429160 7:990844-990866 GAGCCCCTCTGGAGCTCTGGAGG No data
1019429151_1019429168 29 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429151_1019429161 8 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429161 7:990845-990867 AGCCCCTCTGGAGCTCTGGAGGG No data
1019429151_1019429158 -4 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429158 7:990833-990855 GTGTGACTGGTGAGCCCCTCTGG No data
1019429151_1019429159 4 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429159 7:990841-990863 GGTGAGCCCCTCTGGAGCTCTGG No data
1019429151_1019429166 24 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429166 7:990861-990883 TGGAGGGTGCGGAACATTCCAGG No data
1019429151_1019429165 13 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429165 7:990850-990872 CTCTGGAGCTCTGGAGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019429151 Original CRISPR ACACTGGGCGGGGCGTCGCG TGG (reversed) Intergenic