ID: 1019429154

View in Genome Browser
Species Human (GRCh38)
Location 7:990825-990847
Sequence GCTCACCAGTCACACTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019429154_1019429167 14 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429167 7:990862-990884 GGAGGGTGCGGAACATTCCAGGG No data
1019429154_1019429160 -4 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429160 7:990844-990866 GAGCCCCTCTGGAGCTCTGGAGG No data
1019429154_1019429171 26 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429171 7:990874-990896 ACATTCCAGGGCAGGGGCTGTGG No data
1019429154_1019429169 19 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429169 7:990867-990889 GTGCGGAACATTCCAGGGCAGGG No data
1019429154_1019429161 -3 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429161 7:990845-990867 AGCCCCTCTGGAGCTCTGGAGGG No data
1019429154_1019429165 2 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429165 7:990850-990872 CTCTGGAGCTCTGGAGGGTGCGG No data
1019429154_1019429166 13 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429166 7:990861-990883 TGGAGGGTGCGGAACATTCCAGG No data
1019429154_1019429168 18 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429154_1019429170 20 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429170 7:990868-990890 TGCGGAACATTCCAGGGCAGGGG No data
1019429154_1019429159 -7 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429159 7:990841-990863 GGTGAGCCCCTCTGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019429154 Original CRISPR GCTCACCAGTCACACTGGGC GGG (reversed) Intergenic