ID: 1019429156

View in Genome Browser
Species Human (GRCh38)
Location 7:990829-990851
Sequence AGGGGCTCACCAGTCACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019429156_1019429168 14 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429156_1019429171 22 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429171 7:990874-990896 ACATTCCAGGGCAGGGGCTGTGG No data
1019429156_1019429170 16 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429170 7:990868-990890 TGCGGAACATTCCAGGGCAGGGG No data
1019429156_1019429166 9 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429166 7:990861-990883 TGGAGGGTGCGGAACATTCCAGG No data
1019429156_1019429161 -7 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429161 7:990845-990867 AGCCCCTCTGGAGCTCTGGAGGG No data
1019429156_1019429160 -8 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429160 7:990844-990866 GAGCCCCTCTGGAGCTCTGGAGG No data
1019429156_1019429169 15 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429169 7:990867-990889 GTGCGGAACATTCCAGGGCAGGG No data
1019429156_1019429167 10 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429167 7:990862-990884 GGAGGGTGCGGAACATTCCAGGG No data
1019429156_1019429165 -2 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429165 7:990850-990872 CTCTGGAGCTCTGGAGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019429156 Original CRISPR AGGGGCTCACCAGTCACACT GGG (reversed) Intergenic