ID: 1019429163

View in Genome Browser
Species Human (GRCh38)
Location 7:990848-990870
Sequence GCACCCTCCAGAGCTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019429163_1019429168 -5 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429163_1019429171 3 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429171 7:990874-990896 ACATTCCAGGGCAGGGGCTGTGG No data
1019429163_1019429173 28 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429173 7:990899-990921 AATCCCTCCCAGCTGTTGTCAGG No data
1019429163_1019429170 -3 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429170 7:990868-990890 TGCGGAACATTCCAGGGCAGGGG No data
1019429163_1019429167 -9 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429167 7:990862-990884 GGAGGGTGCGGAACATTCCAGGG No data
1019429163_1019429169 -4 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429169 7:990867-990889 GTGCGGAACATTCCAGGGCAGGG No data
1019429163_1019429174 29 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429174 7:990900-990922 ATCCCTCCCAGCTGTTGTCAGGG No data
1019429163_1019429166 -10 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429166 7:990861-990883 TGGAGGGTGCGGAACATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019429163 Original CRISPR GCACCCTCCAGAGCTCCAGA GGG (reversed) Intergenic