ID: 1019429168

View in Genome Browser
Species Human (GRCh38)
Location 7:990866-990888
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019429156_1019429168 14 Left 1019429156 7:990829-990851 CCCAGTGTGACTGGTGAGCCCCT No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429151_1019429168 29 Left 1019429151 7:990814-990836 CCACGCGACGCCCCGCCCAGTGT No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429155_1019429168 17 Left 1019429155 7:990826-990848 CCGCCCAGTGTGACTGGTGAGCC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429163_1019429168 -5 Left 1019429163 7:990848-990870 CCCTCTGGAGCTCTGGAGGGTGC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429162_1019429168 -4 Left 1019429162 7:990847-990869 CCCCTCTGGAGCTCTGGAGGGTG No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429153_1019429168 19 Left 1019429153 7:990824-990846 CCCCGCCCAGTGTGACTGGTGAG No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429154_1019429168 18 Left 1019429154 7:990825-990847 CCCGCCCAGTGTGACTGGTGAGC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429157_1019429168 13 Left 1019429157 7:990830-990852 CCAGTGTGACTGGTGAGCCCCTC No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data
1019429164_1019429168 -6 Left 1019429164 7:990849-990871 CCTCTGGAGCTCTGGAGGGTGCG No data
Right 1019429168 7:990866-990888 GGTGCGGAACATTCCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019429168 Original CRISPR GGTGCGGAACATTCCAGGGC AGG Intergenic
No off target data available for this crispr