ID: 1019431515

View in Genome Browser
Species Human (GRCh38)
Location 7:1001813-1001835
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 3, 1: 0, 2: 40, 3: 48, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431504_1019431515 10 Left 1019431504 7:1001780-1001802 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG 0: 3
1: 0
2: 40
3: 48
4: 340
1019431509_1019431515 -6 Left 1019431509 7:1001796-1001818 CCTGTGGGTAGGGAGTCCTGTGG 0: 2
1: 36
2: 21
3: 23
4: 185
Right 1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG 0: 3
1: 0
2: 40
3: 48
4: 340
1019431498_1019431515 28 Left 1019431498 7:1001762-1001784 CCTGCGGGTGAGTGGAGTCCTGT 0: 5
1: 43
2: 33
3: 2
4: 77
Right 1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG 0: 3
1: 0
2: 40
3: 48
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900145093 1:1155672-1155694 CTTTGGGAGTGGAGCCCTTTGGG + Intergenic
900388260 1:2420369-2420391 AGGTGGGTGTGGGGGCCTGTGGG + Intergenic
902816453 1:18919166-18919188 CTGTGGGTGGGGGGAGCTGTTGG - Intronic
903069811 1:20721628-20721650 CCGTGGGAGGGGAGCCCTGAGGG - Exonic
903744014 1:25574557-25574579 CTGTGTGTCGGGAGCCCTGTGGG + Intergenic
904123662 1:28220823-28220845 CTGTGTGCTTGGAGCCATGTTGG - Intronic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
910357560 1:86377524-86377546 CTGCGGGGGTGGAGCCCTTATGG - Intronic
911009356 1:93262837-93262859 CTGTGGAGGTGGAGCCCTCATGG - Intronic
912823395 1:112885036-112885058 CTGTGGGTGATGAGCCAGGTGGG + Intergenic
912834653 1:112985573-112985595 CTGTGAGAGTGGAGCCCTCAGGG + Intergenic
915694128 1:157721918-157721940 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
918323051 1:183382997-183383019 CTGCAGGTGTGGAGCCCTCATGG - Intronic
920108756 1:203572604-203572626 GTGTGGGTGTGTGGCTCTGTGGG - Intergenic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920161442 1:204001390-204001412 CTGAGGGTGTAAATCCCTGTGGG + Intergenic
920852478 1:209637838-209637860 ATGTGGGCGTGGAGCCATGGAGG - Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
922433066 1:225575129-225575151 CTGTGTGTGTGGAGCAGTGAGGG - Intronic
922769440 1:228174113-228174135 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769443 1:228174129-228174151 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769446 1:228174145-228174167 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769449 1:228174161-228174183 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769452 1:228174177-228174199 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769455 1:228174193-228174215 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769458 1:228174209-228174231 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769461 1:228174225-228174247 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769464 1:228174241-228174263 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769467 1:228174257-228174279 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769470 1:228174273-228174295 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769473 1:228174289-228174311 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769476 1:228174305-228174327 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769479 1:228174321-228174343 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769482 1:228174337-228174359 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769485 1:228174353-228174375 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769488 1:228174369-228174391 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769491 1:228174385-228174407 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769494 1:228174401-228174423 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769497 1:228174417-228174439 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769500 1:228174433-228174455 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769503 1:228174449-228174471 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769506 1:228174465-228174487 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922769509 1:228174481-228174503 CTGTGGGCGTGGCTCGCTGTGGG + Intronic
922977951 1:229800813-229800835 CTGTGGCAGTGGATCCCTCTTGG + Intergenic
923687393 1:236162817-236162839 CTGTGGGGGTGGGGCCCTCATGG + Intronic
924043890 1:240009241-240009263 CTGAGGGTGAGGAGGCCTGGAGG + Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064145425 10:12822954-12822976 CTGTGTGTTTGCAGCCCTGCTGG + Intronic
1066454986 10:35564989-35565011 CTGTGGGTGGGCACCCCTGGGGG + Intronic
1069713940 10:70508809-70508831 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1069713946 10:70508847-70508869 GTGTGTGTGTGCAGGCCTGTGGG + Intronic
1070393447 10:75990833-75990855 CTGTGGGTGTGGAGGACTTCTGG + Intronic
1070988820 10:80713607-80713629 ATGTGGGTGGTGAGCCATGTGGG + Intergenic
1073047736 10:100650736-100650758 TTGAGGGTGTGGAGCCTTGAAGG - Intergenic
1073326482 10:102646353-102646375 CTCTGGGTGGGGATCCCTGGAGG + Intronic
1073473109 10:103736010-103736032 TGGTGGGTGAGGAGCCCTGGAGG + Intronic
1073679107 10:105682884-105682906 CTATTGTAGTGGAGCCCTGTTGG + Intergenic
1073831099 10:107384519-107384541 ATGTTTCTGTGGAGCCCTGTGGG - Intergenic
1076088476 10:127657547-127657569 CTGTGGGGCTGGAGTCCTGCAGG - Intergenic
1076405513 10:130209915-130209937 CTCTGGGTTTGGACCCCTGATGG - Intergenic
1076495653 10:130895991-130896013 CTGTGGGTTTAGAGCCCTCCAGG + Intergenic
1076501343 10:130938834-130938856 CTTTCGGTGTTGAGCCCTGAAGG - Intergenic
1077133067 11:984244-984266 CTGTGGTCGGGGGGCCCTGTGGG + Intronic
1077184121 11:1228837-1228859 CTGGGGGTGGGGAGGCCTGGGGG + Intronic
1077237252 11:1487687-1487709 CTGTCGGTGTGAAGCCCTGTAGG + Intronic
1077254297 11:1573481-1573503 CTGGGGGTGGGGAGTACTGTGGG + Intergenic
1077323123 11:1951228-1951250 CTGTAGGTGTGGAGCCCGGCAGG + Intronic
1077375428 11:2203268-2203290 CTGTGCCTGTGGGGCCCTGCAGG - Intergenic
1077459229 11:2700428-2700450 CCCTCGGTGTGGAGGCCTGTGGG + Intronic
1078108473 11:8373344-8373366 CTGGGGGTGTGGAGCCCTCATGG + Intergenic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1081516141 11:43832138-43832160 CAGTGGGAGTGGACCCCTGATGG + Intronic
1081685111 11:45036888-45036910 CTGTGGGTGTGAAGCTCTCCAGG - Intergenic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083727802 11:64637424-64637446 CTGGAGGTGGGGAGCCCAGTAGG + Intronic
1084267711 11:68013343-68013365 CTGTGGGCCGGGAGCTCTGTGGG - Intronic
1084274582 11:68044859-68044881 CTGGAGATGTAGAGCCCTGTGGG - Intronic
1085196110 11:74672821-74672843 CTGTGGATGTGGCCCTCTGTGGG - Intergenic
1085439849 11:76549992-76550014 ATGTGGTGGTGGAGCCCAGTGGG + Exonic
1085844672 11:80051436-80051458 CTTTGGGTTTAGAGCACTGTGGG + Intergenic
1086184955 11:84002417-84002439 CTGTGGGAGAGGAGCCCTCATGG - Intronic
1086769555 11:90745078-90745100 CTGTAGGAGTGGAGCCCTCATGG + Intergenic
1087229966 11:95650034-95650056 CTGTGGGCCTGGAGACCTTTTGG - Intergenic
1087675634 11:101158306-101158328 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1087877484 11:103375282-103375304 CTGTAGGGTTGGAGCCCTCTTGG + Intronic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1089189908 11:116646225-116646247 CTGTGGGTTTGATGCCCTATTGG - Intergenic
1089692235 11:120194074-120194096 CTGTGGGGATGAACCCCTGTAGG + Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090599871 11:128358917-128358939 CTGTGAGTGTGAAGCGCTGAGGG + Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1202806109 11_KI270721v1_random:6423-6445 CTGTAGGTGTGGAGCCCGGCAGG + Intergenic
1091804815 12:3348237-3348259 CTGCAGGTGGGGTGCCCTGTGGG + Intergenic
1093148081 12:15590298-15590320 CCGTGGGTGTGTACCCTTGTGGG + Intronic
1096687221 12:53296152-53296174 CTGTGGGTGCTGTGCCCTGTTGG + Intronic
1096749691 12:53751155-53751177 CTGTGCGTGCGGAGGCCTGTGGG - Intergenic
1096788530 12:54031338-54031360 CCGCGGGACTGGAGCCCTGTCGG + Intronic
1096874325 12:54615396-54615418 CTGTGGGTGTGGAGCTGGATGGG + Intergenic
1098558441 12:71845578-71845600 ATTTGGGTGTGGAGCCCATTAGG + Intronic
1098715192 12:73821358-73821380 CTGTAGGAGTGGAGCCCTCATGG - Intergenic
1101541262 12:105667579-105667601 CTGTGGGTGAGAGGCTCTGTGGG - Intergenic
1103058746 12:117842132-117842154 CTCTGGGAGTGGAACCCTCTGGG + Intronic
1105634468 13:22203995-22204017 CTATTGGTGTGGCACCCTGTAGG + Intergenic
1106312115 13:28563418-28563440 CTGTGGGTGGGAAGACCTGTTGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1109086093 13:57973112-57973134 CTGTAGGGGTGGAGCCCTTATGG - Intergenic
1111568485 13:90047771-90047793 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1111641948 13:90980219-90980241 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1112623641 13:101078153-101078175 CTGTGGGGGTAGAGCCCTCATGG + Intronic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113713709 13:112488730-112488752 TGGTGGGTGTGGAGACCTGGGGG - Intronic
1114472332 14:22972474-22972496 CTGTGGGTGTGGAGCTTGTTGGG - Exonic
1114936783 14:27548798-27548820 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1118764209 14:68899299-68899321 CTGTGGGTGTGGTGTGCTGTGGG - Intronic
1119642528 14:76325919-76325941 CTGTGGGTGTGCAGCACAGGCGG - Intronic
1121729860 14:96179052-96179074 GGGTGGGTCTAGAGCCCTGTGGG - Intergenic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1123131887 14:105994026-105994048 GTGGGTGTGTGGGGCCCTGTTGG + Intergenic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1124641806 15:31400592-31400614 CTGGGGGTGAGGTGCCCTGCAGG + Intronic
1128107137 15:65053479-65053501 CTGTGGGTCGGGAAGCCTGTAGG + Exonic
1129503515 15:76061455-76061477 CTGGAGGTGGGGAGCCCTGAGGG + Intronic
1130274440 15:82469180-82469202 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130466787 15:84196554-84196576 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130497477 15:84476982-84477004 CAGTGGGGTTGGAGCCCTGGTGG - Intergenic
1130589082 15:85201147-85201169 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130833641 15:87628553-87628575 CTGCAGGTGTTGAGACCTGTGGG - Intergenic
1132242106 15:100265939-100265961 CGGTGGGTGTGGAGCAGGGTGGG - Intronic
1132535485 16:477400-477422 CTGTGAGTGTGCAATCCTGTTGG + Intronic
1132605362 16:791461-791483 CCGTGGGTGTGGTGACGTGTGGG + Intronic
1132612861 16:825962-825984 CTTTCGGTGTCGAGCGCTGTGGG + Intergenic
1132899052 16:2243546-2243568 TTGTGGGTGTTGAACCCTGCGGG - Intronic
1133221544 16:4321100-4321122 CTGTGTGTGCGGTGCCCTGCTGG + Intronic
1133239502 16:4405844-4405866 CTGTTGGTGGGGAGCTATGTTGG - Intronic
1134047891 16:11114687-11114709 CCCTGGCTGTGGAGCCCTGGGGG - Intronic
1134188028 16:12099596-12099618 CGGTGAGGGTGGAGTCCTGTCGG + Intronic
1135417887 16:22282877-22282899 TTGTGGATGGGGAGCCCAGTGGG + Intronic
1136082967 16:27864942-27864964 CTGTGTTTCTGGAGCCCGGTAGG - Intronic
1139566667 16:67781886-67781908 TTGTGAGTGTGGACACCTGTGGG - Intronic
1139637158 16:68264635-68264657 CTGTGGGAGCCGAACCCTGTGGG + Intronic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140995037 16:80250866-80250888 CTTTGGGAGTGCAGCCCAGTAGG - Intergenic
1141424562 16:83936545-83936567 CCGAGGGTGTGGAGCTCTGGGGG - Intronic
1144042873 17:11428706-11428728 CTGTGTGATTGCAGCCCTGTGGG - Intronic
1144745228 17:17609460-17609482 CTGTGGCTCTGCTGCCCTGTAGG - Intergenic
1144787609 17:17840572-17840594 CTGTGGGTTTCGAGCCTTTTCGG + Intergenic
1144820305 17:18068464-18068486 CTGTGGCTGTGGAGCTCTCCAGG + Intergenic
1147968191 17:44205542-44205564 CTGGGGGTGGGGAGGCCTGGGGG - Exonic
1148031241 17:44622636-44622658 CTATGGGTGTGAGGGCCTGTGGG - Intergenic
1148225482 17:45895685-45895707 CAGTGGGTGTGGACCCTGGTGGG + Intronic
1148560041 17:48600872-48600894 CTGTGAGTCTGCAGTCCTGTGGG + Intronic
1148588666 17:48799218-48799240 CTGTGGGGAGGGAGCCCTCTAGG - Intronic
1148656857 17:49290708-49290730 GTGTGGGTGTGGAGTCCTTGTGG - Intronic
1148686103 17:49502093-49502115 CTGTGTGTGTACAGGCCTGTGGG - Exonic
1149896603 17:60433207-60433229 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
1151951424 17:77356335-77356357 CTGTGGCTGTGGAACCTTGGTGG + Intronic
1152264646 17:79287306-79287328 CTGTGGGTGGGGAGTGCTATGGG - Intronic
1152352573 17:79791757-79791779 CTGGGGGTGTGGCGCGCTGGAGG + Intergenic
1152575510 17:81139017-81139039 CTGTGGGTGTGCACACGTGTGGG - Intronic
1152727926 17:81956791-81956813 CTGTGGGTGGGGAGCCCCGGGGG - Intronic
1153981498 18:10314576-10314598 GTGTGGCTGTGGAGGCCTTTAGG + Intergenic
1153993845 18:10422903-10422925 CTGTGCCTGTGGAGTCATGTGGG + Intergenic
1155245523 18:23905062-23905084 GTGTGTCTGTGGAGTCCTGTGGG + Intronic
1157300318 18:46474372-46474394 CAGGGGGTGGGGAGGCCTGTGGG + Intergenic
1159022793 18:63156782-63156804 CTTTGGGTGTGGAGTCCCCTTGG - Intronic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1160212691 18:76895726-76895748 CTGTGTGGGTGCAGCACTGTGGG - Intronic
1160399081 18:78596068-78596090 CAGTGTGGGTGGAGCCCTGCTGG + Intergenic
1160700057 19:501823-501845 GGGTGTGTGTGGAGCCCTGCTGG - Exonic
1160709966 19:547007-547029 CTGTGGCTGTGGGGCCCAGTGGG + Intronic
1160862584 19:1244041-1244063 CTGAGGCTGTGCAGCCCTTTGGG + Intronic
1161295843 19:3519870-3519892 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161295862 19:3519945-3519967 CTGTGGGTGTGGGGCCCCCCGGG - Intronic
1161343359 19:3754367-3754389 CTGTGGGAGTGGGCCCCTGGGGG - Intronic
1161395964 19:4045162-4045184 CTTGGGGGGTGGAGCCCTCTGGG - Exonic
1162735823 19:12746469-12746491 CTGGTGGTGTGCAGCACTGTGGG - Intronic
1164477706 19:28588033-28588055 ATCTGAGTGTGGAGCCCTGCAGG + Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
1166709579 19:44927967-44927989 GTGTTTGTGTGGAGCCCTGGAGG + Intergenic
925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG + Intergenic
925494839 2:4435382-4435404 CTGCGGGGGTGGAGCCCTCATGG - Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
927780913 2:25938792-25938814 CTGTGGTTGTGGGGCCCTGCTGG - Intronic
928819468 2:35343073-35343095 CTGTGGGAGGGTGGCCCTGTGGG - Intergenic
929233192 2:39580789-39580811 CTGTGGGTGTGGGACCCTCTGGG + Intergenic
929629669 2:43446509-43446531 ATGTGAGTGTGAAGCCATGTTGG + Intronic
931747126 2:65300281-65300303 CGGTGGGTGTGGTGGCCTCTCGG - Intergenic
934538975 2:95159284-95159306 CTGTGCGTGTGGATCCACGTGGG - Exonic
935311173 2:101785094-101785116 CTGTGTGTGTGCACCCCTCTGGG + Intronic
936193237 2:110347106-110347128 CTGTGGCTGAGGTCCCCTGTAGG + Intergenic
936452324 2:112643047-112643069 CTGTGGGTTTAGAGTCCTCTTGG - Intergenic
936501746 2:113072288-113072310 GCGGGGGTGTGGTGCCCTGTTGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937449011 2:121985040-121985062 CTGTGAGGGTGGAGCCCTCATGG + Intergenic
937895335 2:126973478-126973500 GTGTGGGTGTGGAGCCAGTTTGG - Intergenic
938140543 2:128791326-128791348 ATGTGTGGGGGGAGCCCTGTCGG - Intergenic
938367345 2:130745147-130745169 TGGTGGGTGAGGAGCCCTGCGGG - Intergenic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
944055198 2:195515866-195515888 CTGCAGGTCTGGAGCCCTGCAGG - Intergenic
944486752 2:200214770-200214792 CTTTGGATGTGGAGCGCTGGAGG - Intergenic
944757003 2:202773824-202773846 CTGTGCAAGTGCAGCCCTGTGGG + Exonic
945037215 2:205714742-205714764 CTGTGGGAGTCCAGCCCTGTGGG + Intronic
945330732 2:208536604-208536626 CTGTGGAGGTGGAGCCCTCGTGG - Intronic
946143628 2:217712642-217712664 CTCTCAGTGTGGAGCTCTGTGGG + Intronic
948867019 2:240780759-240780781 GTGTGTGTGTGGAGCTGTGTGGG - Intronic
948873764 2:240816989-240817011 CTGAGGGTGGGGATCCCAGTGGG + Intronic
1170617974 20:17969232-17969254 CCGTGGGTGCGGACCCCTGGCGG - Intronic
1172518690 20:35553639-35553661 CTGTGGGGGTGGGGCTGTGTTGG + Intronic
1173793581 20:45843506-45843528 CGGTGAGTGTGGGGCCGTGTGGG - Exonic
1174298734 20:49567690-49567712 TTGTGGGTGGGGAGCCGTGCGGG - Intronic
1174965324 20:55207877-55207899 CTGTGGGAGTGGAACCCTCATGG + Intergenic
1175648127 20:60693532-60693554 CTGTGGGGTCGGAGCCCTGCAGG - Intergenic
1176026004 20:62985975-62985997 CTGTGGTTGTGGGGCCCCGAGGG - Intergenic
1177244928 21:18510712-18510734 CTGTGGCAGTGGAGCCCTCATGG + Intergenic
1179834979 21:44025137-44025159 CTGTTGGGATGGAGCCCTGCAGG + Intronic
1180016975 21:45093457-45093479 CTGTGGGTGCCGAGCCCTCTGGG + Intronic
1180051720 21:45334738-45334760 GAGTGGGAGTGGAGCCCTGGAGG - Intergenic
1180171040 21:46058368-46058390 CTGTGAGTGTGTGGACCTGTGGG - Intergenic
1180226516 21:46396474-46396496 CTGTGAGGGTGGAGCCCTTGCGG + Intronic
1180699122 22:17772311-17772333 CTGTGAGTGGGAGGCCCTGTGGG + Intronic
1180967826 22:19799717-19799739 CGGTGGGTGAGGACACCTGTGGG + Intronic
1181968436 22:26672523-26672545 ACGTGAGTGTGGAGGCCTGTTGG + Intergenic
1182146603 22:28000616-28000638 AGGCGGGTGCGGAGCCCTGTGGG + Intronic
1183464658 22:37973544-37973566 CTGTGGGACTGGGGCCCTGAGGG + Exonic
1184278520 22:43424422-43424444 GTGTGGGCGTGGGGCCATGTGGG + Intronic
1184823350 22:46929917-46929939 ATGTGTGTGTGGACCCCTTTGGG + Intronic
1185068142 22:48642193-48642215 CTGAGGGTGCCAAGCCCTGTGGG + Intronic
949868556 3:8567594-8567616 CTGTGGGTGGGCAGCCCTTCAGG - Exonic
950190556 3:10973570-10973592 CTGAGGGTTAGGAGCCCCGTAGG + Intergenic
951177560 3:19619104-19619126 CTGCGGGAGTGGAGCCCTCATGG - Intergenic
952480212 3:33753696-33753718 CTGTAGGGGTGGAGCCCTCATGG - Intergenic
952749952 3:36816978-36817000 GTGTGGGAGTGGGGTCCTGTGGG - Intergenic
953349244 3:42202381-42202403 CTGTGGCCTTGGAGCCCTGCTGG + Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
956157349 3:66312420-66312442 CTGTGGGGGTGGAGCCTACTGGG + Intronic
959228658 3:103619030-103619052 CTGCAGGTGTGGAGCCCTCATGG - Intergenic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
962744092 3:138384646-138384668 CTGTAGGAGGGGAGACCTGTGGG + Intronic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
968275219 3:197436301-197436323 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275240 3:197436387-197436409 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275395 3:197437118-197437140 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275414 3:197437204-197437226 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275451 3:197437376-197437398 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275522 3:197437720-197437742 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968275555 3:197437849-197437871 GGGTTGGAGTGGAGCCCTGTTGG + Intergenic
968521781 4:1037480-1037502 CTGTGAGTGTGTGGCCCTGGAGG + Intergenic
968521801 4:1037560-1037582 CTGTGAGTGTGTGGCCCTGGAGG + Intergenic
968549582 4:1215189-1215211 CAGTGGGTTTGGAGCCTTCTAGG - Intronic
968666117 4:1823230-1823252 CTGTGTGTGTGAAGCCCAGGTGG - Intronic
968912907 4:3484971-3484993 CTGTGGCCTTGGAGCCCTGAGGG + Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969311074 4:6353503-6353525 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311135 4:6353699-6353721 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311145 4:6353731-6353753 CTGTCGGTGTGGGGGGCTGTTGG - Intronic
969311209 4:6353927-6353949 CTGTTGGTGTGGGGGGCTGTCGG - Intronic
969538611 4:7771914-7771936 CTGTGCGGGTGGTGCCCGGTAGG + Intronic
973159128 4:46993824-46993846 CTGTGGGCGGGGAGCCCACTTGG - Exonic
974628463 4:64453603-64453625 CTGCAGGTGTGGAGCCCTCAGGG - Intergenic
975650545 4:76588640-76588662 CTGGGGTTGGGGAGGCCTGTAGG + Intronic
976758258 4:88521678-88521700 CTGTGCTAGTGCAGCCCTGTGGG + Exonic
978343340 4:107739982-107740004 TTGTGGCTGTGGCTCCCTGTGGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
983649829 4:170026657-170026679 CTGCGGGTGTGGGGCTCTGGGGG - Intronic
985183990 4:187296374-187296396 CTGTGGGGGTGGGGCCCTCATGG - Intergenic
987762860 5:22188132-22188154 TTGTGGGGGTGGATCCCTGATGG + Intronic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991897646 5:71421530-71421552 TTGTGGGGGTGGATCCCTGATGG + Intergenic
993706346 5:91175930-91175952 CTGTGGGTGCCAAACCCTGTGGG + Intergenic
994567339 5:101466957-101466979 CTCTGGCAGTGGATCCCTGTGGG - Intergenic
997432020 5:133847397-133847419 CTGTGTGTGTGGCTCCCTGGAGG - Intergenic
997665271 5:135625482-135625504 CTGTGGGAGTGCAGCCATCTAGG - Intergenic
998864939 5:146489123-146489145 CTGGCGTTGTGTAGCCCTGTAGG + Intronic
999202328 5:149825164-149825186 CTCTGGGCGTGGGGGCCTGTGGG + Intronic
999462583 5:151770540-151770562 CTGCGGGAGTGGAGCCCTGGGGG + Exonic
1002318827 5:178362938-178362960 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002318854 5:178363018-178363040 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002426010 5:179176371-179176393 ATGTGGGTCTGGAGCCCTGCGGG - Intronic
1002527223 5:179821372-179821394 CTGGGGCGGTGGAGCCCTGCCGG + Intronic
1002888569 6:1316061-1316083 CTGTGGGTGAGGCACACTGTGGG - Intergenic
1003005559 6:2377882-2377904 CTCTGTGTGTGGTGCCCTCTCGG + Intergenic
1003986681 6:11442734-11442756 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1005101130 6:22173504-22173526 CTGTTGGGGTGGAGCCCTCATGG + Intergenic
1006284076 6:33079936-33079958 CTGTGGGGGTAGAGTCCTTTGGG - Intronic
1007704029 6:43780411-43780433 CTGTGAGTGTGGAGACCTTTGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008588780 6:52972503-52972525 CTGGGGGTGTAGAACCCTGAAGG + Intergenic
1010768069 6:79798790-79798812 CTGGGGGGGTGGGGCCTTGTGGG - Intergenic
1011981679 6:93386678-93386700 ATGTAGGTGTGGAGCCCTCGTGG - Intronic
1013551216 6:111209600-111209622 CTGTGGGTTAAGAGGCCTGTGGG + Intronic
1013551220 6:111209616-111209638 CTGTGGGTTAGGAAGCCTGTGGG + Intronic
1014374762 6:120659150-120659172 CTGCAGGGGTGGAGCCCTGATGG - Intergenic
1015653517 6:135491274-135491296 CAGGAGGTATGGAGCCCTGTAGG - Intronic
1017121180 6:151025228-151025250 CAGTGGGCATGGAGCCCTGTGGG - Intronic
1017958727 6:159203377-159203399 CTGTGAGGGTGAAGCCATGTGGG + Intronic
1018818717 6:167356206-167356228 CTCTGCGCGTGGAGTCCTGTGGG - Intronic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431399 7:1001423-1001445 CTGTGGGTGGGGATTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431431 7:1001545-1001567 GTGGGTGAGTGGAGCCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431462 7:1001627-1001649 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431476 7:1001679-1001701 CTGCGGGTGGGGAGTCCTGCGGG + Intronic
1019431482 7:1001695-1001717 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431511 7:1001797-1001819 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431548 7:1001913-1001935 CTGCGGGTGGGGAGTCCTGCGGG + Intronic
1019431554 7:1001929-1001951 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431588 7:1002049-1002071 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431594 7:1002065-1002087 CTGTGGGTGGGGAGTCCTCTGGG + Intronic
1019431598 7:1002083-1002105 CTGGGTGAGTGGAGTCCTGTGGG + Intronic
1019431603 7:1002099-1002121 CTGTGGGTGGGAAGTCCTGTGGG + Intronic
1019431607 7:1002117-1002139 GTGGGTGAGTGGAGCCCTGTGGG + Intronic
1019431621 7:1002169-1002191 CTGCAGGTGGGGAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431643 7:1002257-1002279 GTGGGTGAGTGGAGCCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431659 7:1002307-1002329 CTGTGGGTAGGGAATCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431689 7:1002407-1002429 CTGCCGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431724 7:1002527-1002549 GTGGGTGAGTGGAGCCCTGTGGG + Intronic
1019431749 7:1002615-1002637 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431772 7:1002703-1002725 GTGGGTGAGTGGAGCCCTGTGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431813 7:1002838-1002860 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431831 7:1002905-1002927 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019431836 7:1002921-1002943 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431864 7:1003025-1003047 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431874 7:1003059-1003081 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431908 7:1003179-1003201 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431978 7:1003439-1003461 CTGCGGGTGGGGAGTCCTGCGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432028 7:1003608-1003630 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432038 7:1003642-1003664 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432057 7:1003710-1003732 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432079 7:1003795-1003817 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432097 7:1003863-1003885 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432141 7:1004017-1004039 CTGCGGGTGGGGAGTCCTGCGGG + Intronic
1019499959 7:1359916-1359938 CTGTGGGTGTGGGGCCCACCAGG + Intergenic
1019595637 7:1857124-1857146 CTGTTGGTGAGGAGTCCTGGAGG - Intronic
1020608113 7:10362801-10362823 CTGTGGGAGTGGAACCCTCATGG + Intergenic
1020736104 7:11950669-11950691 CAGTCAGTATGGAGCCCTGTGGG - Intergenic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1026557515 7:71421108-71421130 CTGTGGCTGGTGAGCCCTGGCGG + Intronic
1029124668 7:98287862-98287884 GTGTGGGTGGGGAGCCCGGCTGG - Intronic
1029686176 7:102149617-102149639 CTGTGGCTGTCGTGCCCTGATGG - Intronic
1032197964 7:129800056-129800078 GTGTGGGTGGGGAGCTCTGCGGG + Intergenic
1032429171 7:131847010-131847032 GTGTGGGTGGGGAGGCGTGTTGG + Intergenic
1032524703 7:132571222-132571244 GTGTGGGTGTGAATCCCTGAAGG - Intronic
1032787476 7:135211865-135211887 CAGGGGGTGCGGCGCCCTGTTGG + Intergenic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1033005064 7:137552461-137552483 AAGTGGATGGGGAGCCCTGTAGG - Exonic
1033419077 7:141189872-141189894 CTGTGCGTGTGGAACCCTGAAGG + Intronic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035488647 7:159252802-159252824 GTGTGTGTCTGGAGCCCTGGGGG - Intergenic
1036509535 8:9387622-9387644 CTGTGGGTGTGGCTCCCTCCAGG + Intergenic
1036560764 8:9898803-9898825 CTGCGGCTGGGGAGCGCTGTGGG + Intergenic
1037925696 8:22842636-22842658 CTATGGCTGTGCAGGCCTGTTGG - Intronic
1041195845 8:55400661-55400683 CTGTGGGAATGGAGACCTTTTGG - Intronic
1041314878 8:56550664-56550686 CTGTGGGTGTGGGACCCTCTGGG - Intergenic
1041770812 8:61471009-61471031 CTGTGTACGTGGAGCCCTGGAGG - Intronic
1042211264 8:66382865-66382887 CTGTGGGTGTGAACTCCTGATGG - Intergenic
1042484764 8:69337336-69337358 GTGGGGATGGGGAGCCCTGTTGG + Intergenic
1044303938 8:90616671-90616693 CTGCAGGGGTGGAGCCCTGAGGG + Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045849295 8:106673954-106673976 CTGTAGGGGTGGAGCCCTCTTGG + Intronic
1046311226 8:112440588-112440610 CTGCAGGGGTGGAGCCCTCTTGG - Intronic
1046495630 8:115010249-115010271 CTGTAGGGGTGGAGCCCTTATGG - Intergenic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047627217 8:126668433-126668455 CAGTGGGAGAGGAGCCCAGTGGG + Intergenic
1047830192 8:128621182-128621204 CTGGGGGCTTGGAGGCCTGTGGG + Intergenic
1048681084 8:136842658-136842680 CTATGTGTTAGGAGCCCTGTGGG + Intergenic
1048995865 8:139793404-139793426 CTGCTGGGGTGGAGCCCTGTGGG - Intronic
1049032751 8:140049535-140049557 CTCGGGGGGGGGAGCCCTGTAGG - Intronic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1049452074 8:142667371-142667393 CCGTGGTTGTGGAGCCAGGTGGG - Intronic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1049780516 8:144426609-144426631 CTGTGTGTGGTGAGCCTTGTTGG - Intronic
1050253177 9:3767404-3767426 CTGTGGGTGGGTAGCTCTTTTGG + Intergenic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1052632778 9:31062055-31062077 CAGTGGGTGTAGCGCACTGTGGG - Intergenic
1053271605 9:36753498-36753520 CTGTGCGTGTGCAGGCATGTGGG + Intergenic
1054815974 9:69475945-69475967 ATGTGGGTCAGGAGCGCTGTAGG + Intronic
1057221536 9:93260228-93260250 GTAGGGGTGTGGATCCCTGTGGG - Intronic
1059380579 9:113920243-113920265 CTATTGGCGTGGAGCCCTTTAGG + Intronic
1059948982 9:119442426-119442448 CTGTGGATGGGGAGCAGTGTGGG - Intergenic
1060815464 9:126632837-126632859 TTCTGGGTGTGGGGCCCAGTGGG - Intronic
1061888512 9:133605552-133605574 CTGTGGGAGTGGGTCCCTGCCGG - Intergenic
1062405649 9:136395005-136395027 CTGTGGGGGTGCAACCCTGCCGG + Intronic
1062595706 9:137298219-137298241 CTGAGAGGGTGGAGCCCTGGAGG - Intergenic
1186470320 X:9816446-9816468 CGGTGGGTGTGGGCCCCTGCAGG + Intronic
1187476472 X:19615463-19615485 CTGAGGGTGTGAGGCCCTCTGGG - Intronic
1187555202 X:20344716-20344738 CTGTAGGGGTGGAGCCCTCATGG + Intergenic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1193406443 X:81107499-81107521 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1193948182 X:87764199-87764221 CTGTGGAGGTGGAGCCCTTATGG - Intergenic
1196812775 X:119641838-119641860 CTGTTGGTGTAAAGCCCTTTTGG - Intronic