ID: 1019431645

View in Genome Browser
Species Human (GRCh38)
Location 7:1002271-1002293
Sequence CAGGATTCCACTCACCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 4, 2: 3, 3: 12, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431645_1019431659 13 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431659 7:1002307-1002329 CTGTGGGTAGGGAATCCTGTGGG 0: 1
1: 2
2: 38
3: 29
4: 190
1019431645_1019431660 18 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431660 7:1002312-1002334 GGTAGGGAATCCTGTGGGTGTGG 0: 1
1: 1
2: 10
3: 30
4: 254
1019431645_1019431662 28 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431645_1019431654 -3 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG 0: 35
1: 19
2: 16
3: 31
4: 322
1019431645_1019431655 1 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431655 7:1002295-1002317 GGGTGGGGAGTCCTGTGGGTAGG No data
1019431645_1019431663 29 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG No data
1019431645_1019431656 2 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431656 7:1002296-1002318 GGTGGGGAGTCCTGTGGGTAGGG 0: 2
1: 8
2: 11
3: 33
4: 304
1019431645_1019431653 -4 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431653 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG No data
1019431645_1019431658 12 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431658 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 44
3: 43
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019431645 Original CRISPR CAGGATTCCACTCACCCACA GGG (reversed) Intronic
900590356 1:3456713-3456735 CAGGAGACCTGTCACCCACACGG + Intronic
901113242 1:6816513-6816535 CAGGAAGCCTCTCGCCCACAGGG - Intronic
903749101 1:25608759-25608781 CACGGCTCCACTCAACCACAAGG + Intergenic
904661662 1:32090092-32090114 CAGAATTACACACCCCCACAAGG - Intronic
905209799 1:36366273-36366295 CAGGATTCGACTCAAGCAAATGG + Intronic
906811965 1:48836254-48836276 CAGCATCCCTCTCACCCACCAGG + Intronic
910544669 1:88400399-88400421 CAGGATTCCAGTGACCTCCAAGG + Intergenic
912570418 1:110617242-110617264 CTGGAATCCACTCACCCATTTGG - Intronic
919527063 1:198666323-198666345 CATGATTCCACACATACACATGG - Intronic
921174629 1:212583466-212583488 CAGGATTACAGGAACCCACAGGG + Intronic
924905958 1:248452932-248452954 CATGATTCTGCTCATCCACATGG + Exonic
924921931 1:248639102-248639124 CATGATTCTGCTCATCCACATGG - Exonic
1062902517 10:1156799-1156821 CAGGAGAACACTCAACCACACGG - Intergenic
1065478268 10:26164637-26164659 CAGGAATCCACACATCCACAGGG + Intronic
1067147784 10:43706215-43706237 GAGGCTGCCACTCACCCTCAGGG + Intergenic
1069857422 10:71449011-71449033 CAGGGTTCCAGTCACCAAAATGG + Intronic
1069899011 10:71696302-71696324 CAGGATTCATGTCCCCCACAGGG - Intronic
1074067743 10:110033005-110033027 CCACATTCCCCTCACCCACAAGG - Intronic
1081567712 11:44270151-44270173 CCACATTCCACTCCCCCACATGG - Intronic
1081981355 11:47269276-47269298 CAGCATTCCATTTACCCATATGG - Intronic
1083131488 11:60628099-60628121 CAGGATTCCAATAATACACATGG - Intergenic
1085046910 11:73358991-73359013 CAGGCTGCCTCTCACCCCCACGG + Intronic
1085784666 11:79439399-79439421 CAGTAATACACTCATCCACATGG + Intronic
1089171340 11:116513743-116513765 CAAGAATCCTCTCACCCACCCGG + Intergenic
1090300165 11:125629080-125629102 CAGGAGTCCACTAACACATATGG - Intronic
1090808062 11:130215264-130215286 CTGGAGTCCACTCAGCCAGACGG + Intergenic
1091027912 11:132158485-132158507 CAGGCTACCACTCTCCAACACGG - Intronic
1094388261 12:29919015-29919037 GAGGATTCCACTCAACAACATGG - Intergenic
1094480839 12:30880311-30880333 CAGGAATCAATTCTCCCACATGG - Intergenic
1095330115 12:40949991-40950013 CAGGATACCAGGCAGCCACAGGG + Intronic
1095923489 12:47555355-47555377 CAGGGTAGAACTCACCCACATGG - Intergenic
1096622456 12:52873090-52873112 CAGGTTCCCACTCAGCCCCAGGG - Intergenic
1100306228 12:93352444-93352466 CAAGCTTCCTCTCACCCACGTGG - Intergenic
1100957087 12:99920838-99920860 CTGAATGACACTCACCCACATGG + Intronic
1104332791 12:127862963-127862985 CAAGATTCATCTCACCTACATGG + Intergenic
1105386601 13:19935670-19935692 CAGGATTCCACTCTCACCCAGGG + Intergenic
1108108401 13:47039268-47039290 CTGGATTCCACAAACCCTCAAGG - Intergenic
1109798800 13:67347790-67347812 CACGGTTCCATTCTCCCACAAGG - Intergenic
1110012919 13:70361955-70361977 CAAGGTTCCACACACCCTCAAGG - Intergenic
1111149369 13:84229000-84229022 AAGCATTCCATTCAGCCACACGG + Intergenic
1112383872 13:98919660-98919682 CAGGGTTCCCCTCACACAGAAGG - Intronic
1113682368 13:112253387-112253409 GAGGATTCCGTTCACCCACCAGG - Intergenic
1114830387 14:26134232-26134254 CAGTTTTCCCCTGACCCACAAGG - Intergenic
1118386953 14:65263850-65263872 CAGGATACCACTCACTATCAAGG - Intergenic
1120562161 14:86008627-86008649 CAACTTTCCAGTCACCCACAGGG + Intergenic
1122820540 14:104342667-104342689 CAGGATTGCACGCACCCACACGG - Intergenic
1123490023 15:20773546-20773568 CATGATTCCATCCAACCACAAGG - Intergenic
1123546524 15:21342633-21342655 CATGATTCCATCCAACCACAAGG - Intergenic
1127442484 15:59023820-59023842 CAGGATTCAGCTCACAGACATGG - Intronic
1129845806 15:78767274-78767296 CAGGTTCCCTCCCACCCACAAGG + Intronic
1130256056 15:82326586-82326608 CAGGTTCCCTCCCACCCACAAGG - Intergenic
1130598897 15:85263400-85263422 CAGGTTCCCTCCCACCCACAAGG + Intergenic
1130756599 15:86770946-86770968 CAGGACTGCACTCAGTCACATGG - Intronic
1202954854 15_KI270727v1_random:69848-69870 CATGATTCCATCCAACCACAAGG - Intergenic
1134665587 16:16016100-16016122 CAGAAACCCACTCAGCCACAGGG - Intronic
1137715094 16:50593670-50593692 CTCCATTCCTCTCACCCACATGG - Intronic
1138435313 16:56995590-56995612 CAGGATCCATCCCACCCACAAGG - Intronic
1140976395 16:80063785-80063807 CAGGGTTCCACTCCCTCACCAGG - Intergenic
1141769775 16:86082786-86082808 CAGGCTTGCACTGACCCCCATGG - Intergenic
1141807976 16:86354511-86354533 CAGGATGGCACTAACCCACCAGG + Intergenic
1144442721 17:15298374-15298396 CATGGATCCACTCATCCACAAGG + Intergenic
1144610882 17:16714091-16714113 CAGGATCTCACTCACTCACCTGG + Intronic
1144901861 17:18601295-18601317 CAGGATCTCACTCACTCACCTGG - Intergenic
1144929206 17:18844650-18844672 CAGGATCTCACTCACTCACCTGG + Intronic
1145130642 17:20344775-20344797 CAGGATCTCACTCACTCACCTGG + Intergenic
1147969151 17:44210495-44210517 CAGCCTTCCACCCACCCCCAGGG + Intronic
1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG + Exonic
1151304376 17:73253579-73253601 CCGCATTCCACTTACCCACCTGG - Intronic
1151406693 17:73892166-73892188 CATGATTCCATCCAACCACAGGG + Intergenic
1152335052 17:79695913-79695935 CAGGATGCAACCCACTCACAGGG + Intergenic
1152624900 17:81383708-81383730 CAGGGCTCCACTCGCCCCCATGG + Intergenic
1154233545 18:12580974-12580996 CATGATTCCACTTATCCCCATGG + Intronic
1154447624 18:14448303-14448325 CATGATTCCATCCAACCACAAGG - Intergenic
1155578353 18:27274615-27274637 CAGGCTTCCATTCTTCCACATGG - Intergenic
1156243788 18:35278157-35278179 GAGGATTCCACTGACCCAGAGGG - Intronic
1156379342 18:36543635-36543657 CAGGATCCCTGTCACCCACTGGG + Intronic
1163211777 19:15846073-15846095 CAAGATTACACTCATCTACACGG + Intergenic
1164200764 19:23016386-23016408 CAGGATTCAACACACCTAGAAGG - Intergenic
1167848980 19:52187861-52187883 CAGGACTCCTCTCAGCCCCAAGG - Intergenic
924960341 2:29053-29075 CAGCATTGCATTCACCCACCAGG - Intergenic
925022636 2:583843-583865 CACGTCCCCACTCACCCACAAGG + Intergenic
930730361 2:54723388-54723410 CAGGATTCCGCGCGCCCAGAGGG - Intergenic
931979257 2:67677026-67677048 CAGGATTCCTCTCACACATTGGG - Intergenic
932139746 2:69264849-69264871 GAGAATTCCTCTCAGCCACAGGG + Intergenic
933823224 2:86134147-86134169 CAGGATTCCAGAAACCCACCAGG - Intronic
935382874 2:102470819-102470841 CAGCATCCCACTCACACACCAGG - Intergenic
938084432 2:128389516-128389538 CAGGAGACCAGTCACCCAGATGG - Intergenic
939309752 2:140460786-140460808 CAGAATTCCACTCAAGCACTAGG + Intronic
940860665 2:158767537-158767559 CAGAATGTCACACACCCACAAGG + Intergenic
946265445 2:218537313-218537335 CAGGTTTCCACTCACTCTCTTGG + Intronic
947140665 2:227016895-227016917 CAGGGCTCCTCTCACCCAGATGG - Intronic
947998128 2:234545396-234545418 CAGGATTACACACACCCAGGAGG + Intergenic
948366173 2:237456261-237456283 TAGCATTCCACTCACCCAGGTGG - Intergenic
948853502 2:240719603-240719625 CAGGCTGCCCCTGACCCACATGG - Intronic
1170987509 20:21272076-21272098 CAGGACTCCACTCAGCCAGATGG - Intergenic
1172356653 20:34285027-34285049 CATGAACCCACACACCCACAGGG - Intronic
1173071553 20:39773289-39773311 CATGCTGCCACCCACCCACAAGG - Intergenic
1176448573 21:6842359-6842381 CATGATTCCATCCAACCACAAGG + Intergenic
1176826743 21:13707381-13707403 CATGATTCCATCCAACCACAAGG + Intergenic
1180879647 22:19194784-19194806 CAGGAATCCACTTAGCCATAGGG - Intronic
1181018508 22:20085265-20085287 CAGCAATCCACTCACCTGCAAGG - Intronic
1182183131 22:28372412-28372434 CAGCATTTCACTCACCCACATGG + Intronic
950463320 3:13138527-13138549 CAGGAGCCTACTCACCCACCTGG - Intergenic
952546047 3:34420495-34420517 CAGGGCTCAAGTCACCCACAAGG - Intergenic
955505730 3:59631427-59631449 CATGATTCCAAACAACCACATGG - Intergenic
961426807 3:126854869-126854891 CAGGATTCCACCCAGCCCCTTGG - Intronic
966087790 3:176090900-176090922 CAGGCTTCCAAGCACCCACCTGG + Intergenic
969307166 4:6332446-6332468 CTGGAAGCCACACACCCACAAGG - Intronic
969639504 4:8388562-8388584 CAGGCTCCGCCTCACCCACACGG - Intronic
979440100 4:120741350-120741372 CATGCTTACACTCACTCACATGG + Intronic
982069381 4:151682242-151682264 CAGGCTTCCTCACACCCATAGGG + Intronic
986185193 5:5429245-5429267 CAAGATTCCAGACCCCCACAAGG + Intronic
993844511 5:92923981-92924003 TAGGATTCCACTGGCCTACAAGG + Intergenic
997459364 5:134041775-134041797 CAGGGAGCCACTCACCAACAGGG - Intergenic
997845992 5:137286502-137286524 CAGGTCTGCACTCACCCAGAAGG + Intronic
997988912 5:138527634-138527656 CAGGGGTCCACTCATGCACAGGG + Intronic
998303114 5:141045599-141045621 CAGGGTTCCACTCCCCCTGAAGG + Intergenic
999693522 5:154168771-154168793 CAGAATGCCACTCAGCCACTTGG + Intronic
1000915213 5:167073349-167073371 TATGATTCCACTCACCAAAAGGG - Intergenic
1001635700 5:173208575-173208597 CAGATTTCCACTCCCCCGCATGG - Intergenic
1003449501 6:6218029-6218051 CCGGAATGCACCCACCCACAGGG - Intronic
1004297654 6:14428471-14428493 CAGGGCTCCACCCAGCCACAGGG - Intergenic
1006407867 6:33855762-33855784 GAGGATACAGCTCACCCACAGGG + Intergenic
1007495863 6:42260028-42260050 CTGGATTCCACTCAAACAGATGG - Intronic
1012028901 6:94032933-94032955 CAGGCTTCCACTAAATCACAAGG + Intergenic
1012864042 6:104596227-104596249 GAGGCTTCCACTGATCCACAGGG - Intergenic
1019431366 7:1001319-1001341 CAGGACTCCACTCACCCACATGG - Intronic
1019431609 7:1002131-1002153 CAGGACTCCACTCACCCACAGGG - Intronic
1019431645 7:1002271-1002293 CAGGATTCCACTCACCCACAGGG - Intronic
1019431726 7:1002541-1002563 CAGGACTCCACTCACCCACAGGG - Intronic
1019431735 7:1002577-1002599 CAGGGCTCCACTCACCCGCAGGG - Intronic
1019431740 7:1002595-1002617 CAGGACTCCACTCACCCACAGGG - Intronic
1019431769 7:1002699-1002721 CAGGGCTCCACTCACCCACAGGG - Intronic
1019431774 7:1002717-1002739 CAGGATTCCACTCACCCACAGGG - Intronic
1019944770 7:4318656-4318678 CAGGATTCTGCACAGCCACATGG - Intergenic
1020466556 7:8486202-8486224 CAGAATTCCCTTCAGCCACAGGG + Intronic
1023123877 7:36936016-36936038 CAGGTGTCCACTCACCCTCCAGG + Intronic
1027512257 7:79097529-79097551 CAGGAAGACTCTCACCCACAAGG + Intronic
1032724330 7:134576921-134576943 CATGTTTCCACTCAGCTACAAGG - Intronic
1035319239 7:158017808-158017830 CAGGATTTCACACACGCACAAGG + Intronic
1035599746 8:890648-890670 CAGGTTTGCCCTCACCCACCCGG + Intergenic
1036707226 8:11054920-11054942 CAGGCTTCCACTAGCCCACAGGG - Intronic
1038329745 8:26598721-26598743 CAGGCTCCCATCCACCCACAAGG - Intronic
1045598321 8:103683396-103683418 CAAGAATTCACTCACCCCCAAGG + Intronic
1047941982 8:129835449-129835471 CTGGTTCCCGCTCACCCACATGG - Intergenic
1052457150 9:28714332-28714354 CAGGATCCCAATCACCATCAAGG + Intergenic
1057792341 9:98132458-98132480 CTGGATCCCTCTCATCCACATGG + Intronic
1061739585 9:132691129-132691151 CAGGTTTCCACACACCCAGTTGG + Exonic
1203520618 Un_GL000213v1:42159-42181 CATGATTCCATCCAACCACAAGG - Intergenic
1187827172 X:23343377-23343399 CAGGGATCCACCCTCCCACATGG - Intronic
1188254324 X:27941588-27941610 AAGGGTTCCACTCACACTCATGG + Intergenic
1189145933 X:38654851-38654873 CAGAATTCCACTCCCCCACGGGG - Intronic
1192984941 X:76387690-76387712 CAGTATACCACTTTCCCACAAGG - Intergenic
1194531838 X:95059016-95059038 CAGAGTTCTACTCAACCACAAGG + Intergenic
1195001905 X:100650290-100650312 CAGGCTTCCACTAGCCCACAGGG - Intronic
1198092100 X:133341789-133341811 CAGGTTTAAACTCACCCACAGGG + Intronic
1202181928 Y:22147203-22147225 CGGGATTGCTCTCTCCCACATGG - Intergenic
1202209432 Y:22439199-22439221 CGGGATTGCTCTCTCCCACATGG + Intergenic