ID: 1019431646

View in Genome Browser
Species Human (GRCh38)
Location 7:1002272-1002294
Sequence ACAGGATTCCACTCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 3, 1: 37, 2: 34, 3: 14, 4: 134}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431646_1019431662 27 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431646_1019431655 0 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431655 7:1002295-1002317 GGGTGGGGAGTCCTGTGGGTAGG No data
1019431646_1019431660 17 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431660 7:1002312-1002334 GGTAGGGAATCCTGTGGGTGTGG 0: 1
1: 1
2: 10
3: 30
4: 254
1019431646_1019431654 -4 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG 0: 35
1: 19
2: 16
3: 31
4: 322
1019431646_1019431653 -5 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431653 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG No data
1019431646_1019431658 11 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431658 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 44
3: 43
4: 225
1019431646_1019431659 12 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431659 7:1002307-1002329 CTGTGGGTAGGGAATCCTGTGGG 0: 1
1: 2
2: 38
3: 29
4: 190
1019431646_1019431656 1 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431656 7:1002296-1002318 GGTGGGGAGTCCTGTGGGTAGGG 0: 2
1: 8
2: 11
3: 33
4: 304
1019431646_1019431663 28 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019431646 Original CRISPR ACAGGATTCCACTCACCCAC AGG (reversed) Intronic
903102686 1:21046398-21046420 ACAGGATTTTACACATCCACAGG - Intronic
903134413 1:21300128-21300150 CCAGGATGCTGCTCACCCACTGG + Intronic
907158084 1:52352751-52352773 ACAGGCTACCACTGGCCCACTGG + Exonic
913691827 1:121286845-121286867 ACAGGATGCCAGTGACCCACTGG - Intronic
914145719 1:144993109-144993131 ACAGGATGCCAGTGACTCACTGG + Intronic
914416712 1:147490868-147490890 ACAGTTCTCCACCCACCCACCGG + Intergenic
915505505 1:156353457-156353479 CCAGAATTCCACTCACCACCTGG + Intronic
916127113 1:161581428-161581450 ACAGGATTCCCATCACTCCCTGG - Intronic
916137033 1:161663232-161663254 ACAGGATTCCCATCACTCCCTGG - Exonic
916445270 1:164866262-164866284 ACAGTAATCTACTCACACACTGG + Intronic
920479159 1:206305353-206305375 ACAGGATGCCAGTGACCCACTGG - Intronic
920773951 1:208917441-208917463 CCAAGATTTCACTCAACCACAGG + Intergenic
1065478267 10:26164636-26164658 TCAGGAATCCACACATCCACAGG + Intronic
1070761179 10:79025291-79025313 ACAGGCATGCACACACCCACAGG + Intergenic
1072835661 10:98709267-98709289 ACAGAATTTCACTCTCCCAGTGG - Intronic
1073991156 10:109263399-109263421 ACATAAATCCACTCACTCACTGG - Intergenic
1076166183 10:128284619-128284641 ACAGGAACCCACTGACCCGCAGG - Intergenic
1077068421 11:655561-655583 AGACGCTGCCACTCACCCACTGG - Intronic
1077241285 11:1511751-1511773 ACAGGATTTTGCACACCCACGGG - Intergenic
1077597539 11:3546926-3546948 GCGTCATTCCACTCACCCACAGG + Intergenic
1082785188 11:57312872-57312894 ACAGGAGTCCCCTCTCCCCCTGG - Exonic
1084253639 11:67922832-67922854 GCATCATTCCACTGACCCACAGG + Intergenic
1084819242 11:71673095-71673117 GCATCATTCCACTGACCCACAGG - Intergenic
1088970777 11:114773113-114773135 CCAGGCTTCCACTCAAACACAGG + Intergenic
1089161291 11:116439606-116439628 ACAGGGTGCCACTCACAGACAGG + Intergenic
1091411015 12:239320-239342 ACACCATTCCCCTCAGCCACCGG + Intronic
1092360592 12:7833128-7833150 ATAGAATTCCACTCACGAACTGG + Intronic
1092373193 12:7934208-7934230 ATAGAATTCCACTCACGAACTGG + Intronic
1092423715 12:8356220-8356242 GCATCATTCCACTGACCCACAGG + Intergenic
1095869053 12:47005458-47005480 TAAGGCATCCACTCACCCACAGG + Intergenic
1103226547 12:119292749-119292771 ACAGGATGCCACTCTCTCATGGG - Intergenic
1104601417 12:130156383-130156405 ACACCATTCCACTCCCCCAGGGG - Intergenic
1105386600 13:19935669-19935691 ACAGGATTCCACTCTCACCCAGG + Intergenic
1118455803 14:65945060-65945082 ACAGGATTCCTTCCGCCCACTGG + Intergenic
1123019670 14:105391734-105391756 ACAGGCCTCCGCTCACCGACGGG - Exonic
1132172493 15:99675452-99675474 GTAGGAATTCACTCACCCACTGG - Exonic
1141476936 16:84280379-84280401 ACTGGATGCCATTCAACCACGGG - Intergenic
1142102565 16:88283218-88283240 ACAGGATTTCAGTCACCCGAGGG + Intergenic
1142278181 16:89133821-89133843 GCAGGTTCCCACTCACCCACAGG - Intronic
1148677460 17:49453481-49453503 ACAGGATTCCCCTGTCCCAGGGG - Intronic
1150103457 17:62444184-62444206 TCAGGATTCAGCTCAGCCACAGG + Intronic
1151406692 17:73892165-73892187 ACATGATTCCATCCAACCACAGG + Intergenic
1152748123 17:82050555-82050577 CCAGGACTCCCCTCGCCCACAGG - Exonic
1156243789 18:35278158-35278180 TGAGGATTCCACTGACCCAGAGG - Intronic
1156379341 18:36543634-36543656 CCAGGATCCCTGTCACCCACTGG + Intronic
1158302632 18:56068570-56068592 ACTGGAATCATCTCACCCACTGG - Intergenic
1158626529 18:59076553-59076575 AAAGGATTCCAATGAGCCACAGG + Intergenic
1160010931 18:75106754-75106776 ACAGCCTTCCACTCCCCAACAGG - Intergenic
1164784647 19:30920420-30920442 ACACGATGCCACTCTCACACCGG - Intergenic
927668373 2:25048039-25048061 ACAGGATCTCACTCTCCCCCAGG + Intronic
928871873 2:35989832-35989854 GCACGATTCCACTCACCAAATGG - Intergenic
930686003 2:54308897-54308919 ACAGGATTCCACTGAGCCACAGG + Intergenic
931916293 2:66960519-66960541 ACCCCCTTCCACTCACCCACAGG + Intergenic
931979258 2:67677027-67677049 TCAGGATTCCTCTCACACATTGG - Intergenic
938372392 2:130779772-130779794 ACAATATTGCAATCACCCACAGG + Intergenic
938742328 2:134244709-134244731 ACAGGATCTTACTCACCCACTGG - Intronic
945174137 2:207024200-207024222 ACAGGATACAATACACCCACAGG + Intergenic
948302209 2:236915918-236915940 ACAGCACTCCACTGACCCATTGG + Intergenic
1170565917 20:17605153-17605175 TCAGGATCCCAATCACCCAGTGG - Intronic
1173591667 20:44229636-44229658 CCATGATTCCACCCACCCAAAGG + Intergenic
1174084333 20:47994783-47994805 ACAGTATTCCCCTTAGCCACTGG + Intergenic
1174309326 20:49638469-49638491 ACTTTATTCCACTCACACACAGG + Intronic
1178147844 21:29760102-29760124 ACCGGATTCAAATCTCCCACAGG - Intronic
1178620398 21:34169189-34169211 ACAGGATACCACACACAGACTGG + Intergenic
1183389281 22:37535691-37535713 ACAGGATTCCATTTACGCAGAGG + Intergenic
1184443070 22:44530568-44530590 CCAGGGTTCCACTCCCCCTCTGG + Intergenic
950273470 3:11638802-11638824 CCAGGACTCCACTCAACCGCTGG + Intronic
950752903 3:15144956-15144978 GCATCATTCCACTGACCCACAGG - Intergenic
955467838 3:59254798-59254820 ACAGGAATCAACCCACCCAACGG - Intergenic
955612628 3:60774216-60774238 ACAGGATTTCAGGCATCCACTGG - Intronic
957067705 3:75539299-75539321 GCATCATTCCACTGACCCACAGG + Intergenic
958516600 3:95124555-95124577 AAAGGCTTCCAATCCCCCACTGG + Intergenic
959801819 3:110504318-110504340 CAAGGATTCCACACACGCACAGG + Intergenic
960038996 3:113130203-113130225 ATAAGATTCCACTCAACCATAGG + Intergenic
961285450 3:125798677-125798699 GCATCATTCCACTGACCCACAGG - Intergenic
961470341 3:127107447-127107469 ACTGAAGTCCCCTCACCCACTGG - Intergenic
965117453 3:164510369-164510391 ACAGGCTGCCATTCACCAACTGG - Intergenic
966164223 3:176998977-176998999 CCAAGATTCCATTCTCCCACTGG + Intergenic
969741807 4:9033844-9033866 GCATCATTCCACTGACCCACAGG - Intergenic
969801175 4:9566741-9566763 GCATCATTCCACTGACCCACAGG - Intergenic
971043726 4:22782106-22782128 CCAGGTTTCCTCTCTCCCACTGG - Intergenic
973781037 4:54288359-54288381 ACAGGACTCCATTAAGCCACTGG - Intronic
974970126 4:68812892-68812914 ATAGGTTTCATCTCACCCACTGG + Intergenic
975000311 4:69217709-69217731 ATAGGTTTCATCTCACCCACTGG - Intergenic
975005451 4:69277496-69277518 ATAGGTTTCATCTCACCCACTGG + Intergenic
975013870 4:69386483-69386505 ATAGGGTTCATCTCACCCACTGG + Intronic
975853008 4:78592555-78592577 ACATGAATGCACCCACCCACAGG + Intronic
981324328 4:143428495-143428517 ACAGGATGCCCATCACCCAGAGG - Intronic
982069380 4:151682241-151682263 ACAGGCTTCCTCACACCCATAGG + Intronic
982114079 4:152082621-152082643 ACAGGATCCCACTCCCTCCCGGG - Intergenic
984939960 4:184922447-184922469 AAAGGATGCCACACACACACGGG + Intergenic
993410912 5:87572393-87572415 ACATGAATCCACTTACCTACAGG + Intergenic
995380351 5:111524747-111524769 ACAGCATTCAACTCCCCCAGAGG + Intergenic
997988911 5:138527633-138527655 ACAGGGGTCCACTCATGCACAGG + Intronic
1000071224 5:157742899-157742921 AAATGTTTCCACTCACCTACAGG - Intergenic
1001256653 5:170188596-170188618 ACAGGATCCCTTTCAGCCACAGG - Intergenic
1001774191 5:174316346-174316368 ACAGGCATACACTCACACACAGG - Intergenic
1001942643 5:175751458-175751480 ACAGATTTCCACTCTCCCTCTGG - Intergenic
1002005013 5:176225430-176225452 ACAGTATTCCTCTCTCCCAGAGG + Intergenic
1002221361 5:177685195-177685217 ACAGTATTCCTCTCTCCCAGAGG - Intergenic
1003449503 6:6218030-6218052 ACCGGAATGCACCCACCCACAGG - Intronic
1004100266 6:12602341-12602363 ACAGGATCCCGCTCACCAAAAGG - Intergenic
1004297655 6:14428472-14428494 ACAGGGCTCCACCCAGCCACAGG - Intergenic
1004577762 6:16914676-16914698 ACAGGCTTCTACACATCCACCGG - Intergenic
1006185641 6:32180207-32180229 ACAGCTTTCCTCTCTCCCACAGG + Exonic
1006407866 6:33855761-33855783 AGAGGATACAGCTCACCCACAGG + Intergenic
1007991482 6:46260618-46260640 AGAGGGTCCCACTCACCCAAAGG - Intronic
1009985761 6:70779400-70779422 ACTGGATCTCACCCACCCACTGG - Intronic
1011621027 6:89242732-89242754 ACAGGACTGCACTTTCCCACAGG - Intergenic
1012864043 6:104596228-104596250 AGAGGCTTCCACTGATCCACAGG - Intergenic
1016205880 6:141467538-141467560 ACAGGATGCCCATCACCCAGAGG - Intergenic
1019385703 7:754920-754942 ACAGCGTTCCCCTCACCCCCGGG + Intronic
1019431381 7:1001370-1001392 ACAGGACTCCACTCACCCACAGG - Intronic
1019431391 7:1001404-1001426 ACAGGACTCCACTCACCCACAGG - Intronic
1019431401 7:1001438-1001460 ACAGGACTCCACTCACCCACAGG - Intronic
1019431411 7:1001472-1001494 GCAGGACTCCACTCACCCACAGG - Intronic
1019431415 7:1001490-1001512 ACAGGACTCCACTCACCCGCAGG - Intronic
1019431419 7:1001508-1001530 ACAGGATTCCACTCACCCACAGG - Intronic
1019431429 7:1001542-1001564 ACAGGGCTCCACTCACCCACAGG - Intronic
1019431440 7:1001576-1001598 GCAGGACTCCACTCACCCACAGG - Intronic
1019431464 7:1001642-1001664 ACAGGACTCCACTCACCCACAGG - Intronic
1019431468 7:1001660-1001682 GCAGGACTCCACTCACCCACAGG - Intronic
1019431484 7:1001710-1001732 ACAGGACTCCACTAACCCACAGG - Intronic
1019431494 7:1001744-1001766 GCAGGACTCCACTCACCCACAGG - Intronic
1019431498 7:1001762-1001784 ACAGGACTCCACTCACCCGCAGG - Intronic
1019431524 7:1001844-1001866 ACAGGACTCCACTCACCCACAGG - Intronic
1019431534 7:1001878-1001900 ACAGGACTCCACTCACCCACAGG - Intronic
1019431556 7:1001944-1001966 ACAGGACTCCACTCACCCACAGG - Intronic
1019431560 7:1001962-1001984 ACAGGACTCCACTCACCCACAGG - Intronic
1019431570 7:1001996-1002018 ACAGGACTCCACTCACCCACAGG - Intronic
1019431580 7:1002030-1002052 GCAGGACTCCACTAACCCACAGG - Intronic
1019431596 7:1002080-1002102 ACAGGACTCCACTCACCCAGAGG - Intronic
1019431605 7:1002114-1002136 ACAGGGCTCCACTCACCCACAGG - Intronic
1019431610 7:1002132-1002154 ACAGGACTCCACTCACCCACAGG - Intronic
1019431614 7:1002150-1002172 GCAGGACTCCACTCACCCACAGG - Intronic
1019431629 7:1002200-1002222 GCAGGACTCCACTCACCCACAGG - Intronic
1019431633 7:1002218-1002240 GCAGGACTCCACTCACCCGCAGG - Intronic
1019431637 7:1002236-1002258 ACAGGACTCCACTCACCCGCAGG - Intronic
1019431641 7:1002254-1002276 ACAGGGCTCCACTCACCCACAGG - Intronic
1019431646 7:1002272-1002294 ACAGGATTCCACTCACCCACAGG - Intronic
1019431672 7:1002354-1002376 ACAGGACTCCATTCACCCACAGG - Intronic
1019431682 7:1002388-1002410 GCAGGACTCCACTCACCCACAGG - Intronic
1019431698 7:1002438-1002460 ACAGGACTCCACTCACCCACAGG - Intronic
1019431702 7:1002456-1002478 ACAGGACTCCACTCACCCACAGG - Intronic
1019431712 7:1002490-1002512 ACAGGACTCCACTCACCCACAGG - Intronic
1019431722 7:1002524-1002546 ACAGGGCTCCACTCACCCACAGG - Intronic
1019431727 7:1002542-1002564 GCAGGACTCCACTCACCCACAGG - Intronic
1019431731 7:1002560-1002582 GCAGGGCTCCACTCACCCGCAGG - Intronic
1019431736 7:1002578-1002600 ACAGGGCTCCACTCACCCGCAGG - Intronic
1019431741 7:1002596-1002618 GCAGGACTCCACTCACCCACAGG - Intronic
1019431757 7:1002646-1002668 GCAGGACTCCACTCACCCGCAGG - Intronic
1019431761 7:1002664-1002686 GCAGGACTCCACTCACCCGCAGG - Intronic
1019431765 7:1002682-1002704 ACAGGGCTCCACTCACCCGCAGG - Intronic
1019431770 7:1002700-1002722 ACAGGGCTCCACTCACCCACAGG - Intronic
1019431775 7:1002718-1002740 ACAGGATTCCACTCACCCACAGG - Intronic
1019431795 7:1002785-1002807 ACAGGACTCCACTCACCCACAGG - Intronic
1019431805 7:1002819-1002841 GCAGGACTCCACTCACCCACAGG - Intronic
1019431815 7:1002853-1002875 ACAGGACTCCACTCACCCACAGG - Intronic
1019431838 7:1002936-1002958 ACAGGACTCCACTCACCCACAGG - Intronic
1019431842 7:1002954-1002976 ACAGGACTCCACTCACCCACAGG - Intronic
1019431846 7:1002972-1002994 ACAGGACTCCACTCACCCACAGG - Intronic
1019431856 7:1003006-1003028 GCAGGACTCCACTCACCCACAGG - Intronic
1019431866 7:1003040-1003062 GCAGGACTCCACTCACCCACAGG - Intronic
1019431876 7:1003074-1003096 ACAGGACTCCACTCACCCACAGG - Intronic
1019431880 7:1003092-1003114 ACAGGACTCCACTCACCCACAGG - Intronic
1019431890 7:1003126-1003148 ACAGGACTCCACTCACCCACAGG - Intronic
1019431900 7:1003160-1003182 GCAGGACTCCACTCACCCACAGG - Intronic
1019431910 7:1003194-1003216 ACAGGACTCCACTCACCCACAGG - Intronic
1019431914 7:1003212-1003234 ACAGGACTCCACTCACCCACAGG - Intronic
1019431924 7:1003246-1003268 GCAGGACTCCACTCACCCACAGG - Intronic
1019431928 7:1003264-1003286 GCAGGACTCCACTCACCCGCAGG - Intronic
1019431932 7:1003282-1003304 ACAGGACTCCACTCACCCGCAGG - Intronic
1019431936 7:1003300-1003322 ACAGGACTCCACTCACCCACAGG - Intronic
1019431940 7:1003318-1003340 ACAGGACTCCACTCACCCACAGG - Intronic
1019431956 7:1003368-1003390 ACAGGACTCCACTCACCCACAGG - Intronic
1019431960 7:1003386-1003408 ACAGGACTCCACTCACCCACAGG - Intronic
1019431970 7:1003420-1003442 GCAGGACTCCACTCACCCACAGG - Intronic
1019431980 7:1003454-1003476 ACAGGACTCCACTCACCCGCAGG - Intronic
1019431984 7:1003472-1003494 ACAGGACTCCACTCACCCACAGG - Intronic
1019432004 7:1003539-1003561 ACAGGACTCCACTCACCCACAGG - Intronic
1019432020 7:1003589-1003611 GCAGGACTCCACTCACCCACAGG - Intronic
1019432030 7:1003623-1003645 GCAGGACTCCACTCACCCACAGG - Intronic
1019432039 7:1003657-1003679 ACAGGACTCTACTCACCCACAGG - Intronic
1019432049 7:1003691-1003713 GCAGGACTCCACTCACCCACAGG - Intronic
1019432059 7:1003725-1003747 ACAGGACTCCACTCACCCACAGG - Intronic
1019432063 7:1003743-1003765 ACAGGACTCCACTCACCCACAGG - Intronic
1019432087 7:1003826-1003848 ACAGGACTCCACTCACCCACAGG - Intronic
1019432091 7:1003844-1003866 ACAGGACTCCACTCACCCACAGG - Intronic
1019432105 7:1003894-1003916 ACAGGACTCCACTCACCCACAGG - Intronic
1019432109 7:1003912-1003934 ACAGGACTCCACTCACCCACAGG - Intronic
1019432119 7:1003946-1003968 ACAGGACTCCACTCACCCACAGG - Intronic
1019432123 7:1003964-1003986 ACAGGACTCCACTCACCCACAGG - Intronic
1019432133 7:1003998-1004020 GCAGGACTCCACTCACCCACAGG - Intronic
1019878220 7:3834814-3834836 ACAGGCTTCCATGCACTCACTGG - Intronic
1020466555 7:8486201-8486223 ACAGAATTCCCTTCAGCCACAGG + Intronic
1022379257 7:29844326-29844348 ACAGGATCCAACTCAGCCAATGG - Intronic
1023073006 7:36456380-36456402 ACAGGAATCTACTAACACACAGG + Intergenic
1023968770 7:44977103-44977125 ACAGGCTTACAGGCACCCACAGG + Intronic
1024187898 7:46972279-46972301 CCAGGATTTCACTCATCAACTGG + Intergenic
1025810606 7:64873089-64873111 AAAGGATGCTTCTCACCCACTGG + Intronic
1032968330 7:137129466-137129488 ATTGGATTCCAATCTCCCACTGG + Intergenic
1036253795 8:7187955-7187977 GCATCATTCCACTGACCCACAGG + Intergenic
1036363699 8:8099525-8099547 GCATCATTCCACTGACCCACAGG - Intergenic
1036707227 8:11054921-11054943 CCAGGCTTCCACTAGCCCACAGG - Intronic
1036887261 8:12567554-12567576 GCATCATTCCACTGACCCACAGG + Intergenic
1036894855 8:12625655-12625677 GCATCATTCCACTGACCCACAGG + Intergenic
1038529997 8:28310861-28310883 CCAGGACTCAACTCAACCACTGG + Intergenic
1040419777 8:47227777-47227799 ACAGGATTTCACTGTCACACAGG - Intergenic
1041137405 8:54775020-54775042 CCTGGGTTCTACTCACCCACTGG + Intergenic
1043742932 8:83836824-83836846 ACAGCATTGCCCTCACCCTCTGG + Intergenic
1045460846 8:102424528-102424550 ACCAGATTCCATACACCCACGGG - Intergenic
1061425865 9:130498062-130498084 AGAGAGTTCCACGCACCCACCGG + Intronic
1061515951 9:131090564-131090586 ACAGGATTCCACTGGGCCCCTGG - Intronic
1062337120 9:136076458-136076480 ACGGGGTTCCACTCACACGCGGG + Intronic
1186603767 X:11067213-11067235 AAAGTATTCCATTCACCCAAGGG + Intergenic
1189145934 X:38654852-38654874 CCAGAATTCCACTCCCCCACGGG - Intronic
1192880441 X:75277389-75277411 AAAGGATTCCACTTACACCCAGG - Intronic
1195001906 X:100650291-100650313 TCAGGCTTCCACTAGCCCACAGG - Intronic
1198092099 X:133341788-133341810 ACAGGTTTAAACTCACCCACAGG + Intronic
1199057532 X:143315993-143316015 AGAGGAGTCCCCTCATCCACTGG + Intergenic
1199489992 X:148387504-148387526 ACAGATTTTCACTCACCCAAAGG + Intergenic
1199660162 X:150041360-150041382 ACAGGATTACACTGAACCAGAGG + Intergenic