ID: 1019431652

View in Genome Browser
Species Human (GRCh38)
Location 7:1002290-1002312
Sequence CCACAGGACTCCCCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 35, 1: 20, 2: 20, 3: 27, 4: 282}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431652_1019431660 -1 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431660 7:1002312-1002334 GGTAGGGAATCCTGTGGGTGTGG 0: 1
1: 1
2: 10
3: 30
4: 254
1019431652_1019431658 -7 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431658 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 44
3: 43
4: 225
1019431652_1019431670 26 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG No data
1019431652_1019431669 25 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431669 7:1002338-1002360 CCTGTGGGTGGGGAGTCCTGTGG No data
1019431652_1019431663 10 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG No data
1019431652_1019431662 9 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431652_1019431664 13 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431664 7:1002326-1002348 TGGGTGTGGAGCCCTGTGGGTGG No data
1019431652_1019431659 -6 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431659 7:1002307-1002329 CTGTGGGTAGGGAATCCTGTGGG 0: 1
1: 2
2: 38
3: 29
4: 190
1019431652_1019431666 15 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431666 7:1002328-1002350 GGTGTGGAGCCCTGTGGGTGGGG 0: 3
1: 0
2: 15
3: 77
4: 514
1019431652_1019431665 14 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431665 7:1002327-1002349 GGGTGTGGAGCCCTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019431652 Original CRISPR CCACAGGACTCCCCACCCAC AGG (reversed) Intronic
900345871 1:2210025-2210047 CCTCAGGACCCCCCACCCTGAGG - Intronic
900454091 1:2765415-2765437 GAACAGAACTCCACACCCACAGG + Intronic
900455538 1:2772677-2772699 GAACAGAACTCCACACCCACAGG + Intronic
901044535 1:6387775-6387797 ACAAAGGCCTCCCCACGCACAGG + Intronic
901400111 1:9010101-9010123 CCCCATGACTCCCCACCCAGGGG + Intronic
902179640 1:14678177-14678199 CCTCAGGAAGACCCACCCACAGG + Intronic
902571956 1:17352674-17352696 CCACAGTCCTCCCCTCCCAGGGG - Intronic
902715236 1:18268291-18268313 ACACAGGACTACTGACCCACAGG + Intronic
903540575 1:24094007-24094029 CCAGAGGCCTCCCAGCCCACGGG + Intronic
903646024 1:24897019-24897041 CCCCAGGCTTCCCCAGCCACTGG + Intergenic
904310327 1:29625197-29625219 CAACTGGACTCCTCACCCAGAGG + Intergenic
904493542 1:30874515-30874537 CCACTGGGCCCCCCACTCACCGG + Exonic
905665902 1:39763041-39763063 CCACAGGGCCCCCCACCCCAGGG + Intronic
906511629 1:46413389-46413411 AGGCAGGACTCCCCACCCCCAGG - Intronic
911048979 1:93653694-93653716 CCACAGTGTTTCCCACCCACTGG - Intronic
911317334 1:96370925-96370947 CCACAGGCATCCCCACTCCCAGG - Intergenic
912642337 1:111359610-111359632 TCACAGGGCTCCCCACCTATGGG - Intergenic
912775635 1:112504819-112504841 CCACACCACCTCCCACCCACCGG + Intronic
914915827 1:151818653-151818675 CCCCAGGGCTCCCCACTCAGAGG - Intronic
915277498 1:154799701-154799723 GCACAGGTCTCCCCACCCCAGGG - Intronic
915525254 1:156472188-156472210 CCCCAGGCCACCCCACCCTCAGG + Intronic
916503107 1:165403895-165403917 TCACAGCATTCCTCACCCACAGG + Intronic
917603106 1:176597053-176597075 CAAGAGGACTCCCCACACACAGG - Intronic
917712516 1:177701014-177701036 CCACATGACTGCTCACTCACCGG + Intergenic
920516094 1:206585502-206585524 CCACAGGCCTTGCCACACACAGG - Intronic
921113497 1:212063361-212063383 TCACTGCACTCCCCACCCGCTGG + Intronic
921939593 1:220826468-220826490 CCACAAGCCTCCCCAGCCTCAGG + Intergenic
923081707 1:230663043-230663065 CCACAGGACTTAACACCTACAGG - Intronic
923673518 1:236061872-236061894 ACACAGCACTTCACACCCACTGG + Intronic
924037570 1:239953051-239953073 CCCCAGGCCTCCTCACACACCGG + Intergenic
924561192 1:245156925-245156947 CCACAGGCCTCACGGCCCACGGG + Intronic
924954666 1:248914813-248914835 CCACAGGACTCCACAGGCCCTGG - Intronic
1062901129 10:1147749-1147771 AGAAAGCACTCCCCACCCACAGG - Intergenic
1063949558 10:11209319-11209341 CCACAGGAATTCACACCAACGGG + Intronic
1066415200 10:35214980-35215002 CCACAGCTCTCCCCACACCCGGG + Intergenic
1066454984 10:35564988-35565010 CCCCAGGGGTGCCCACCCACAGG - Intronic
1066954034 10:42149063-42149085 GCACAGCCCACCCCACCCACGGG + Intergenic
1069626558 10:69871477-69871499 CCCAAGGACTCCCCACCGACTGG + Intronic
1071682825 10:87724384-87724406 CCACAGGTCTCCCCATCTTCAGG - Intronic
1073045711 10:100637122-100637144 CCAGAAGATTCCCCACCCCCAGG + Intergenic
1074111609 10:110426794-110426816 ACAGAGGAATCCCCACCCGCTGG - Intergenic
1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG + Intergenic
1076759357 10:132593303-132593325 CCGCAGGGCTCCCCACGCCCCGG - Intronic
1076773620 10:132680825-132680847 CCCCAGCAGTGCCCACCCACCGG + Intronic
1076786862 10:132754237-132754259 CCACGGGTCTTCCCACCTACAGG - Intronic
1076796527 10:132801133-132801155 CCCCAGCAGTGCCCACCCACCGG - Intergenic
1076861596 10:133140506-133140528 TCACAGGACCCCCGGCCCACAGG + Intergenic
1077133065 11:984243-984265 CCACAGGGCCCCCCGACCACAGG - Intronic
1077247883 11:1548039-1548061 CCCCAGGACGCCGCCCCCACCGG + Intergenic
1077336542 11:2007504-2007526 CCACAGAAGACCCCACTCACAGG + Intergenic
1077484670 11:2833252-2833274 CCACAGGCCTCCCGTCCCTCAGG - Intronic
1080111138 11:28569260-28569282 ACATGGGACTCCCCACCCACTGG - Intergenic
1080496868 11:32829583-32829605 CCACAGGACTCCTGGCCCAGTGG + Intergenic
1080693893 11:34584176-34584198 TCACAGGACTCCCTCACCACGGG + Intergenic
1083305136 11:61758110-61758132 CAACTGTACTCCCCACCCAGGGG - Intronic
1084173196 11:67410328-67410350 CCCCTGGACTCGCCATCCACTGG - Intronic
1084546930 11:69819280-69819302 CCGCGGGGCTCCCCACCCGCCGG - Intergenic
1084660709 11:70544845-70544867 GCACCGGTGTCCCCACCCACAGG + Intronic
1085393625 11:76195032-76195054 ACTCAGGACCCCACACCCACAGG + Intronic
1085866491 11:80300848-80300870 ACTCCTGACTCCCCACCCACAGG + Intergenic
1089071230 11:115701187-115701209 CCCCAGTCCTCCCCACCCACTGG - Intergenic
1089607299 11:119648820-119648842 CCACTGGAATTCCCACCCTCAGG - Intronic
1089609477 11:119661422-119661444 CCCCAGGTCCCCACACCCACAGG - Exonic
1090665141 11:128909931-128909953 CCACAGCACTCACCACACAACGG - Intronic
1091278797 11:134370390-134370412 CCACAGCACTCACCTCCCCCAGG - Exonic
1202819526 11_KI270721v1_random:62686-62708 CCACAGAAGACCCCACTCACAGG + Intergenic
1091890331 12:4048776-4048798 CCAAAGGCCTCCCCTCCCCCGGG + Intergenic
1094541132 12:31364089-31364111 CCACAGCACTGCTCACCCTCAGG - Intergenic
1094838583 12:34333679-34333701 CAGCAGAAGTCCCCACCCACGGG + Intergenic
1094849038 12:34374110-34374132 CCGCAGAGGTCCCCACCCACGGG - Intergenic
1094854522 12:34397033-34397055 GCAGAGGTCCCCCCACCCACGGG + Intergenic
1096109420 12:49020279-49020301 CCACCCCACTCCCCACCCCCTGG - Exonic
1096749693 12:53751156-53751178 CCACAGGCCTCCGCACGCACAGG + Intergenic
1097046440 12:56190237-56190259 CCTGAGGACTCCCCACCCCTCGG - Intergenic
1097209141 12:57351450-57351472 CCTCAGTACTCACCATCCACAGG - Intronic
1101902480 12:108800812-108800834 CCACAGACCTCCTCGCCCACTGG - Exonic
1102766616 12:115439213-115439235 CCACAAGTCCCTCCACCCACTGG + Intergenic
1103377638 12:120469330-120469352 CCCCAGGGCTCCCCTCCCCCCGG - Intronic
1103923836 12:124413064-124413086 CCACAGGCTTCCCCTCCCTCGGG + Intronic
1104492126 12:129203466-129203488 CCACAGGAGGCTGCACCCACTGG - Intronic
1104974599 12:132546698-132546720 CCTCAGGAGACCCCCCCCACAGG + Intronic
1106519306 13:30483166-30483188 GCCCAGCACTCCTCACCCACAGG + Intronic
1106623884 13:31398574-31398596 CCACAGCATGCCCTACCCACAGG + Intergenic
1106854285 13:33831179-33831201 AAACAGGAGTCCCCAACCACTGG - Intronic
1107666162 13:42693384-42693406 TCACAGGAATCCACATCCACAGG - Intergenic
1108775550 13:53761284-53761306 CCTCTAGGCTCCCCACCCACTGG - Intergenic
1110744760 13:79039351-79039373 CTACAGGACTCCCAGCCGACAGG - Intergenic
1111145340 13:84171016-84171038 CCTCAGGACTCCACACATACTGG + Intergenic
1113245956 13:108395609-108395631 ACACAGCCCTCCACACCCACTGG - Intergenic
1113523222 13:110954867-110954889 CCACGGGCCTCCCTACCCTCGGG + Intergenic
1113613789 13:111666385-111666407 CCCGAGGTCTCCCCACCCAGAGG + Intronic
1113702139 13:112395942-112395964 CCACGGGCCTCCCTACCCTCGGG - Intronic
1113778734 13:112963667-112963689 CCACATGAGGCCACACCCACAGG - Intronic
1113876081 13:113595571-113595593 CCACTAGAATCCCCAACCACAGG - Intronic
1119072564 14:71602671-71602693 ACTCAGGAGTCCCCAACCACTGG + Intronic
1119770665 14:77218954-77218976 GCCCAGGACTCACCACCCACAGG - Exonic
1120972853 14:90222978-90223000 CCTCAGGCCTCCCCAGCCATTGG - Intergenic
1120997055 14:90425028-90425050 CCCCAGGATTCACCACCGACTGG - Intergenic
1121407529 14:93728086-93728108 CCCCCGGACTCCCCAACCTCAGG + Intronic
1122100642 14:99406915-99406937 CCACAGGCCACGCCTCCCACAGG + Intronic
1122148099 14:99706117-99706139 CCCCAGAGCTCCCAACCCACAGG - Intronic
1122272874 14:100576212-100576234 CACCAGAACTTCCCACCCACCGG + Intronic
1124450558 15:29785452-29785474 CAAAAGGTCTGCCCACCCACTGG + Intronic
1124587210 15:31020855-31020877 CCACAGGCCTCGCTTCCCACAGG - Intronic
1125041755 15:35195844-35195866 CCACAGAGATCCCCACCTACTGG + Intergenic
1127089990 15:55457389-55457411 CCACAGCAAGCCCCACCCAAGGG + Intronic
1127867641 15:63044540-63044562 ACCCAGAACTTCCCACCCACTGG - Intronic
1128107136 15:65053478-65053500 CTACAGGCTTCCCGACCCACAGG - Exonic
1131851925 15:96552941-96552963 TCACAGTGATCCCCACCCACTGG + Intergenic
1132233263 15:100200448-100200470 CCACAGTACTCCCCGCACCCAGG + Intronic
1132603237 16:783129-783151 TCACACCCCTCCCCACCCACTGG + Intronic
1133026692 16:2991716-2991738 CCACAGGAGTCCCCACCCACAGG - Intergenic
1133050709 16:3115823-3115845 CCACAGCCCTCCCCTCCCCCCGG + Exonic
1133801964 16:9091819-9091841 CCCCAGGCCTTCCCACCCCCGGG - Exonic
1134188027 16:12099595-12099617 CGACAGGACTCCACCCTCACCGG - Intronic
1134471486 16:14530255-14530277 CCACAGGAATCCCAAGCCCCAGG + Intronic
1135562576 16:23487965-23487987 CCAAAGGGCTCCCCACTCACAGG + Intronic
1137624656 16:49900080-49900102 CCCCAGGGCCCCGCACCCACGGG + Intergenic
1140054705 16:71515937-71515959 CCCCAGGACTATCCACCTACAGG + Intronic
1140898808 16:79349593-79349615 CCATAGGCCTCCTCACCCAGAGG + Intergenic
1140902953 16:79386589-79386611 ATACAGGAGTCCCCATCCACCGG - Intergenic
1141955797 16:87370571-87370593 CCTCAGTCATCCCCACCCACAGG - Intronic
1142412808 16:89924775-89924797 CCCCAGGTCTCCCCTCCCCCAGG - Intronic
1142488013 17:259361-259383 GCAAAGGACCCCACACCCACAGG + Intronic
1142618490 17:1150719-1150741 CAACAGGGCACCCCACCCACTGG + Intronic
1143181465 17:4986859-4986881 CCTCAGGACAACCCACCCTCCGG + Intronic
1143298610 17:5891187-5891209 CCACAGCACTCCCATCCCATGGG - Intronic
1144657100 17:17043538-17043560 CCACAGGTCTCCTCACCCCTCGG - Intronic
1144872098 17:18377928-18377950 CCCAAGGACTCCCCAGCCAAGGG + Exonic
1146255601 17:31390325-31390347 CCAGAGGAAGCCCCACCCAGAGG - Intergenic
1146478295 17:33180802-33180824 CCACAGAACTCCAAACACACAGG - Intronic
1146487447 17:33254912-33254934 CCATAGAACTCCCCAACCAGTGG - Intronic
1149571002 17:57672339-57672361 CCACAGGCCTCCCCACACACAGG + Intronic
1150836871 17:68572268-68572290 CCACAGCATTCAGCACCCACAGG + Intronic
1151972806 17:77467513-77467535 CCACTCCACTCCCCTCCCACCGG + Intronic
1152264648 17:79287307-79287329 CCATAGCACTCCCCACCCACAGG + Intronic
1152294614 17:79459405-79459427 CCACAGGACTCCCCACTTCTTGG - Intronic
1152438116 17:80288451-80288473 CCAGAGGACGCCCCTCCCCCCGG - Intronic
1152578788 17:81156946-81156968 CCACAGGCCTCCCGACACAGGGG + Intronic
1152788899 17:82267491-82267513 CCACAGGAATCGCCACCACCGGG + Intronic
1152850218 17:82629442-82629464 CCAGAGGACTCACAAGCCACAGG + Intronic
1153993843 18:10422902-10422924 CCACATGACTCCACAGGCACAGG - Intergenic
1154228051 18:12526406-12526428 CCACAGCACCCTGCACCCACTGG + Intronic
1154332260 18:13439804-13439826 CCTCAGGGCTCCCGACCCTCTGG - Intronic
1156462135 18:37327084-37327106 CCACAGGCCTCCCCTTCCAGAGG - Intronic
1159824361 18:73188462-73188484 CCTGAGGCCTCCCCAACCACGGG + Intronic
1160456389 18:79005410-79005432 CCACAGGATTCCTTACCCAGTGG + Intergenic
1160738556 19:675820-675842 CCCAACCACTCCCCACCCACAGG + Intergenic
1160950367 19:1664010-1664032 CAAGAGGCCTCCCCACCCCCAGG - Intergenic
1161295645 19:3518965-3518987 CCACAGCCCCACCCACCCACTGG - Intronic
1161470513 19:4454772-4454794 CCATAAGACTCTCCACCCTCAGG + Intronic
1161576378 19:5056806-5056828 CCCCAGGACTCCCCGCCCCAGGG - Intronic
1161576398 19:5056852-5056874 CCCCAGGACTCCCCGCCCCAGGG - Intronic
1161627082 19:5333542-5333564 ACACAGGACCCCCCACCCCAAGG - Intronic
1161769404 19:6223205-6223227 CCCCAGGACTCCACACCCCCAGG + Intronic
1163573512 19:18097642-18097664 CCACAGGGCCCCGCCCCCACTGG - Intronic
1163578065 19:18122143-18122165 CCCCATGACCCCCCACCCCCTGG - Intronic
1165497749 19:36163574-36163596 CCATAGGAGTGCCCACCCAAGGG - Intergenic
1165884898 19:39071044-39071066 GCACATGACTCACCACCAACTGG - Intergenic
1167260512 19:48455321-48455343 CCCCACCACTCCCCACCTACTGG - Exonic
1168341247 19:55624341-55624363 CCACAAGAAGCCCCACCCCCAGG + Intronic
925255466 2:2482701-2482723 CCACCTGACTTCACACCCACAGG - Intergenic
926695923 2:15770243-15770265 CAACAGCACTTCCCACGCACTGG - Intergenic
927516486 2:23674780-23674802 CCTCAGGACACCCCACTCCCTGG + Intronic
928977638 2:37105341-37105363 CCCCAGCACACCCCACCCCCAGG - Exonic
932763734 2:74457536-74457558 CCCCCGGCCTCCCCGCCCACTGG - Exonic
933200362 2:79440907-79440929 CCACAGGGCACCCAACCCAGTGG + Intronic
933730031 2:85449398-85449420 CCACAGGAGGCCTCACCCCCAGG - Intergenic
937249158 2:120512379-120512401 GCTCAGGACACCCCACCCCCAGG - Intergenic
937958763 2:127438653-127438675 TCAGGAGACTCCCCACCCACAGG + Intronic
938216512 2:129522402-129522424 TCTCAGGAAACCCCACCCACAGG - Intergenic
942506301 2:176645029-176645051 CAACTGGCCTCCCCAACCACAGG - Intergenic
948806539 2:240455643-240455665 CCAGGGGCCTCCCCACCCCCAGG - Intronic
1170963130 20:21043155-21043177 CCAGAGGCCTCCCCAGCCATGGG + Intergenic
1172230588 20:33333248-33333270 GCACAGAGCGCCCCACCCACAGG + Intergenic
1172885660 20:38229175-38229197 CCACAGCTCTACCCTCCCACTGG - Intronic
1172973242 20:38888575-38888597 CCCCTGGACTCCTCATCCACGGG + Intronic
1174342203 20:49905064-49905086 CAGCTGGACTCCCCACCCCCTGG - Exonic
1175156152 20:56973024-56973046 ACCCAGGACCCCCCACCCATAGG + Intergenic
1175814664 20:61877224-61877246 CCAGAGATCTCCCCACCCACTGG + Intronic
1175895209 20:62333019-62333041 CCACAGGACCCCCAGCCCCCAGG + Intronic
1176097714 20:63351975-63351997 CCACAGAAGTCCCCACCAATGGG + Intronic
1176287938 21:5028679-5028701 CCACAGGGCACCCCTTCCACAGG - Intronic
1176388689 21:6152316-6152338 GCACACGGCTGCCCACCCACAGG - Intergenic
1177578896 21:22994183-22994205 CCACAGCAAGCCCCACCCACGGG + Intergenic
1179394535 21:41026260-41026282 CTACAGGACTCCAGAACCACTGG + Intergenic
1179734783 21:43385932-43385954 GCACACGGCTGCCCACCCACAGG + Intergenic
1179801246 21:43812403-43812425 CCACGGCACTCCGCACCCACGGG - Intergenic
1179869243 21:44234796-44234818 CCACAGGGCACCCCTTCCACAGG + Intronic
1179896651 21:44366965-44366987 CCACAGCCCACCCCACCCGCCGG - Intronic
1180699120 22:17772310-17772332 CCACAGGGCCTCCCACTCACAGG - Intronic
1181064458 22:20299044-20299066 CCACAGCAGGCCCCGCCCACCGG - Intergenic
1183411241 22:37655900-37655922 CCACCGGACTCTCCACTCTCCGG + Exonic
1184531955 22:45061881-45061903 CCACAGGATTCCCCAGCTCCGGG - Intergenic
1184892593 22:47388999-47389021 TCCCAGGACTCCCAAGCCACTGG - Intergenic
950040234 3:9915378-9915400 CCACGTGCCTCCCCTCCCACAGG - Exonic
952205739 3:31180658-31180680 GCACAGGGATCCCCACCCAGGGG - Intergenic
952227355 3:31392038-31392060 CCAATGTACTACCCACCCACAGG + Intergenic
952955590 3:38555434-38555456 CCAGGACACTCCCCACCCACAGG - Intronic
953114485 3:39978360-39978382 CCACAGTGCTCGTCACCCACTGG - Intronic
953475933 3:43205950-43205972 CAAAAGCATTCCCCACCCACTGG + Intergenic
954304155 3:49716758-49716780 CCACAGGACGGCACACCCTCCGG - Intronic
954643006 3:52113346-52113368 CCACATTACTCACCAGCCACTGG + Intronic
954696197 3:52428326-52428348 TCCCAGGACATCCCACCCACAGG + Intergenic
955348983 3:58180269-58180291 GTCCAGGACTCCCCACCCAAGGG + Intergenic
956826020 3:72997213-72997235 CCACAGGGCTCCCCGCCCCTGGG - Intronic
958778057 3:98509456-98509478 CCACAGCACTCTCCACTCAAAGG + Intronic
960691210 3:120348706-120348728 CCCGAGGCCTCCCCACCCTCCGG + Intronic
962744090 3:138384645-138384667 CCACAGGTCTCCCCTCCTACAGG - Intronic
963062271 3:141234525-141234547 CCACAGGAAGCAACACCCACTGG - Intronic
964497041 3:157302413-157302435 CCAAAGGCCTCCCCTCCCAATGG - Intronic
964613945 3:158642589-158642611 ACACAGGAGTCCCCAACCTCTGG - Intergenic
966653145 3:182323679-182323701 TCACAGAACTCCAAACCCACTGG + Intergenic
967184090 3:186930672-186930694 GCCCAGGACTCCCCTCCCCCAGG - Exonic
967976161 3:195035797-195035819 ACAGAGGCCTCCTCACCCACTGG + Intergenic
968231847 3:197009040-197009062 CCACAGGTCTGCCCACCCCCCGG + Intronic
968285513 3:197506322-197506344 CCACAGCTCTCTCCACCCTCAGG + Intergenic
968691372 4:1992069-1992091 CCCCAGGATTTCCCACCCGCAGG - Intronic
969101970 4:4776172-4776194 CCCTAGGACTCCCCAGACACAGG + Intergenic
969252395 4:5976692-5976714 TCATAGGAGTGCCCACCCACTGG + Intronic
969428892 4:7141438-7141460 CCACAGCCCTCCCCACCCCCTGG - Intergenic
969663587 4:8544508-8544530 CCACAGCCCCCCCCAACCACAGG - Intergenic
970333240 4:15004519-15004541 CCACTGCCCTCCCAACCCACCGG - Intronic
970792221 4:19871901-19871923 CCACAGGTTGCCCCAGCCACAGG - Intergenic
971238372 4:24864504-24864526 CAACAGCACTCCCCACTCCCTGG + Intronic
971472299 4:27040292-27040314 CCACAGCAAGCCCCACCCAAGGG - Intergenic
972312724 4:37895917-37895939 CCACAGGATTCCACCCCAACGGG - Intronic
973264126 4:48194114-48194136 CCACAGGGTTTCCCACCCTCAGG - Intronic
975650544 4:76588639-76588661 CTACAGGCCTCCCCAACCCCAGG - Intronic
978512992 4:109541797-109541819 CCACCCCACCCCCCACCCACAGG + Intergenic
981256028 4:142660989-142661011 CTCCAGGAATCCCCTCCCACTGG - Intronic
982154997 4:152510560-152510582 CCACAGATCTCTCCAGCCACAGG + Intronic
985681429 5:1257877-1257899 CAACAGGCCTCCCGAGCCACTGG - Intronic
985915261 5:2913331-2913353 ACACAGAACTCCACACTCACTGG - Intergenic
986067451 5:4248926-4248948 CCACAGCACTCCCCCTCCAGGGG - Intergenic
987295287 5:16545116-16545138 TCACAGGACTCTCCACATACTGG - Intronic
988713544 5:33802473-33802495 CCACAGGATGGACCACCCACTGG + Intronic
994329908 5:98492460-98492482 TCACAGGAAGCCACACCCACAGG + Intergenic
995853252 5:116569169-116569191 CCACAGCACTCCCCACCTCTTGG - Intronic
996091792 5:119358651-119358673 CCTCAGGAAGCCCCATCCACTGG - Intronic
999466060 5:151806168-151806190 CCACAGCTCCACCCACCCACAGG - Exonic
1000889038 5:166782362-166782384 CCCCAGGACTCCCCCCCACCAGG + Intergenic
1000963864 5:167631778-167631800 CCCCTCGACTCCCCACCCTCAGG + Intronic
1002331169 5:178442023-178442045 CAACCTGAGTCCCCACCCACGGG + Intronic
1003527065 6:6907131-6907153 CCACAGCACTCCCCAGCCCCAGG + Intergenic
1006035846 6:31211458-31211480 CCAGAGGACCACCCACCCAGAGG + Intergenic
1006284078 6:33079937-33079959 CCAAAGGACTCTACCCCCACAGG + Intronic
1008641208 6:53464738-53464760 CCACAGGACTTACATCCCACTGG + Intergenic
1012444551 6:99294476-99294498 ACACAGGTCTACCCACACACTGG + Intronic
1013551214 6:111209599-111209621 CCACAGGCCTCTTAACCCACAGG - Intronic
1013551218 6:111209615-111209637 CCACAGGCTTCCTAACCCACAGG - Intronic
1015985875 6:138883570-138883592 CCAGAGGCCTCCCAGCCCACAGG - Intronic
1016467158 6:144337026-144337048 CCACTGGAGGCCTCACCCACTGG + Intronic
1018440280 6:163806144-163806166 CCACTGGCCTCACCACCCACAGG - Intergenic
1019431370 7:1001338-1001360 CCACAGGGCTCCACACCCACAGG - Intronic
1019431377 7:1001354-1001376 CCACAGGACTCCCCACCCACAGG - Intronic
1019431387 7:1001388-1001410 CCACAGGACTCCCCACCCACAGG - Intronic
1019431397 7:1001422-1001444 CCACAGGAATCCCCACCCACAGG - Intronic
1019431407 7:1001456-1001478 CCACAGGACTCCCCACCCACAGG - Intronic
1019431425 7:1001526-1001548 CCACAGGACTCCCCACCCACAGG - Intronic
1019431436 7:1001560-1001582 CCACAGGACTCCCCACCCACAGG - Intronic
1019431448 7:1001594-1001616 CGGCAGGACCCCCCACCCGCAGG - Intronic
1019431453 7:1001610-1001632 CCGCAGGACTCCCCACCGGCAGG - Intronic
1019431460 7:1001626-1001648 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431474 7:1001678-1001700 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431480 7:1001694-1001716 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431490 7:1001728-1001750 CCACAGGACTCCCCACCCACAGG - Intronic
1019431504 7:1001780-1001802 CCACAGGACTCCCCACCCACAGG - Intronic
1019431509 7:1001796-1001818 CCACAGGACTCCCTACCCACAGG - Intronic
1019431513 7:1001812-1001834 CCACAGGGCTCCACACCCACAGG - Intronic
1019431520 7:1001828-1001850 CCACAGGACTCCCCACCCACAGG - Intronic
1019431530 7:1001862-1001884 CCACAGGACTCCCCACCCACAGG - Intronic
1019431540 7:1001896-1001918 CCGCAGGACTCCCCACCCACAGG - Intronic
1019431546 7:1001912-1001934 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431552 7:1001928-1001950 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431566 7:1001980-1002002 CCACAGGACTCCCCACCCACAGG - Intronic
1019431576 7:1002014-1002036 CCACAGGACTCCCCACCCACAGG - Intronic
1019431586 7:1002048-1002070 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431592 7:1002064-1002086 CCAGAGGACTCCCCACCCACAGG - Intronic
1019431601 7:1002098-1002120 CCACAGGACTTCCCACCCACAGG - Intronic
1019431619 7:1002168-1002190 CCACAGGACTCCCCACCTGCAGG - Intronic
1019431625 7:1002184-1002206 CCACAGGACTCCCCACCCACAGG - Intronic
1019431652 7:1002290-1002312 CCACAGGACTCCCCACCCACAGG - Intronic
1019431657 7:1002306-1002328 CCACAGGATTCCCTACCCACAGG - Intronic
1019431661 7:1002322-1002344 CCACAGGGCTCCACACCCACAGG - Intronic
1019431668 7:1002338-1002360 CCACAGGACTCCCCACCCACAGG - Intronic
1019431678 7:1002372-1002394 CCACAGGACTCCCCACCCACAGG - Intronic
1019431687 7:1002406-1002428 CCACAGGACTCCCCACCGGCAGG - Intronic
1019431694 7:1002422-1002444 CCACAGGACTCCCCACCCACAGG - Intronic
1019431708 7:1002474-1002496 CCACAGGACTCCCCACCCACAGG - Intronic
1019431718 7:1002508-1002530 CCACAGGACTCCCCACCCACAGG - Intronic
1019431747 7:1002614-1002636 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431753 7:1002630-1002652 CCGCAGGACTCCCCACCCACAGG - Intronic
1019431781 7:1002736-1002758 CCACAGGACTCCCCACCCACAGG - Intronic
1019431788 7:1002752-1002774 CCCAAGGACTCCCCACCCACAGG - Intronic
1019431801 7:1002803-1002825 CCACAGGACTCCCCACCCACAGG - Intronic
1019431811 7:1002837-1002859 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431822 7:1002871-1002893 CCCAAGGACTCCCCACCCACAGG - Intronic
1019431829 7:1002904-1002926 CCACAGGACTCCAAACCCACAGG - Intronic
1019431834 7:1002920-1002942 CCACAGGACTCCCTACCCACAGG - Intronic
1019431852 7:1002990-1003012 CCACAGGACTCCCCACCCACAGG - Intronic
1019431862 7:1003024-1003046 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431872 7:1003058-1003080 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431886 7:1003110-1003132 CCACAGGACTCCCCACCCACAGG - Intronic
1019431896 7:1003144-1003166 CCACAGGACTCCCCACCCACAGG - Intronic
1019431906 7:1003178-1003200 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431920 7:1003230-1003252 CCACAGGACTCCCCACCCACAGG - Intronic
1019431946 7:1003336-1003358 CCACAGGACTCCCCACCCACAGG - Intronic
1019431952 7:1003352-1003374 CCACAGGACTCCCCACCCACAGG - Intronic
1019431966 7:1003404-1003426 CCACAGGACTCCCCACCCACAGG - Intronic
1019431976 7:1003438-1003460 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431990 7:1003490-1003512 CCACAGGACTCCCCACCCACAGG - Intronic
1019431997 7:1003506-1003528 CCCAAGGACTCCCCACCCACAGG - Intronic
1019432010 7:1003557-1003579 CCACAGGACTCCCCACCCACAGG - Intronic
1019432016 7:1003573-1003595 CCACAGGACTCCCCACCCACAGG - Intronic
1019432026 7:1003607-1003629 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432036 7:1003641-1003663 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432045 7:1003675-1003697 CCACAGGACTCCCCACCCACAGG - Intronic
1019432055 7:1003709-1003731 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432070 7:1003761-1003783 CCCAAGGACTCCCCACCCACAGG - Intronic
1019432077 7:1003794-1003816 CCACAGGACTCCAAACCCACAGG - Intronic
1019432083 7:1003810-1003832 CCACAGGACTCCCCACCCACAGG - Intronic
1019432095 7:1003862-1003884 CCACAGGACTCCAAACCCACAGG - Intronic
1019432101 7:1003878-1003900 CCACAGGACTCCCCACCCACAGG - Intronic
1019432115 7:1003930-1003952 CCACAGGACTCCCCACCCACAGG - Intronic
1019432129 7:1003982-1004004 CCACAGGACTCCCCACCCACAGG - Intronic
1019432139 7:1004016-1004038 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019498643 7:1353127-1353149 CCACCGCCTTCCCCACCCACTGG + Intergenic
1021798671 7:24283783-24283805 CAACAGGACTACCAACCCACTGG - Intergenic
1021830497 7:24602985-24603007 CCACATGGCTCCCCAGCCTCAGG - Intronic
1022824467 7:33994752-33994774 CCACAGGTCTCCTCACTCCCAGG - Intronic
1023401673 7:39796023-39796045 CCACTGGACTGCCCCCCAACTGG + Intergenic
1023509674 7:40938137-40938159 CAACAGGAGTCCCCATCCCCAGG - Intergenic
1024647947 7:51384652-51384674 CCACTGGACTGCCCCCCAACTGG - Intergenic
1025128760 7:56364819-56364841 CCACTGGACTGCCCCCCAACTGG - Intergenic
1025832426 7:65064200-65064222 CCTCAGAAGTCCCCTCCCACTGG + Intergenic
1025902194 7:65753737-65753759 CCTCAGAAGTCCCCTCCCACTGG + Intergenic
1026737334 7:72957407-72957429 CCACAGGACACCACAGCCACAGG + Intergenic
1026787536 7:73311405-73311427 CCACAGGACACCACAGCCACAGG + Intergenic
1027106398 7:75407661-75407683 CCACAGGACACCACAGCCACAGG - Intronic
1028506971 7:91581468-91581490 GCACAAGGCTCCCCACACACTGG - Intergenic
1028572461 7:92306034-92306056 CCCCAGGCCACCCCACCCTCTGG + Intronic
1029105103 7:98168317-98168339 CCACTGGTCCCCCCGCCCACTGG - Intronic
1032089181 7:128902764-128902786 CCTCAGGACTCACCAGGCACCGG + Exonic
1033504482 7:141986181-141986203 CAAAAGGAATCCCCACCCATGGG - Intronic
1034297417 7:149986709-149986731 GCACAAAACTCCCCACCCATTGG + Intergenic
1034808608 7:154110145-154110167 GCACAAAACTCCCCACCCATTGG - Intronic
1035302716 7:157907648-157907670 CCCCAGGACACCCCACACGCAGG - Intronic
1035618713 8:1022153-1022175 GCACAGGACTGTCCACCCCCAGG - Intergenic
1036560762 8:9898802-9898824 CCACAGCGCTCCCCAGCCGCAGG - Intergenic
1036678540 8:10853810-10853832 CCACAGGGCTCCCCACTCACAGG - Intergenic
1036691321 8:10946532-10946554 CCGCAGGACACGCCACCCCCAGG - Intronic
1036692531 8:10952781-10952803 GCACAGGGCTCCCAACCCCCGGG + Intronic
1037912829 8:22754194-22754216 CCCCTGGCCGCCCCACCCACAGG + Intronic
1039123660 8:34176104-34176126 CCACAGGAGGCCACATCCACAGG + Intergenic
1039958300 8:42224040-42224062 GCACAGGAATCCCCAACCCCTGG + Intergenic
1047627215 8:126668432-126668454 CCACTGGGCTCCTCTCCCACTGG - Intergenic
1049205958 8:141363689-141363711 ACATAGCCCTCCCCACCCACCGG - Intronic
1049423303 8:142526259-142526281 CCAGCGAGCTCCCCACCCACAGG - Intronic
1049549784 8:143251841-143251863 CGGCAGGCCTCCCCTCCCACTGG + Intronic
1049744622 8:144258003-144258025 ACACACTACGCCCCACCCACTGG + Intronic
1051484411 9:17592802-17592824 CTATAGGAGTCCCCAGCCACTGG - Intronic
1055200008 9:73648014-73648036 CCTGAGGCCTCCCCAGCCACGGG + Intergenic
1055555573 9:77470184-77470206 CCCCAGTCCTCCCCACCCAGAGG - Intronic
1056318376 9:85413923-85413945 TCACAGGCCTCCCAATCCACAGG + Intergenic
1057197029 9:93121000-93121022 CCACAGGACCCCTCACCCAGTGG - Intergenic
1057730647 9:97605378-97605400 CCCCAGTACTCCCCACCCCCAGG - Intronic
1059375852 9:113880922-113880944 GCACAGGACACCTAACCCACAGG - Intronic
1060267827 9:122122460-122122482 CCAAAGGACTGCAGACCCACAGG + Intergenic
1060293886 9:122330092-122330114 CTACTGTACTCCCCTCCCACCGG + Intergenic
1061393010 9:130328033-130328055 CCACAGAACCCCCCAGCCAGGGG - Intronic
1061798099 9:133100204-133100226 CCACACCACTCCCCAGCCCCAGG - Intronic
1061821258 9:133228248-133228270 CCACAGGAGCCCTCACCCCCAGG + Intergenic
1061834186 9:133318113-133318135 CCACAGGAGCCCTCACCCCCAGG - Intergenic
1062514418 9:136925481-136925503 CCCCAGCCCTCCCCAGCCACCGG - Intronic
1062615331 9:137393582-137393604 CCACAGCCCTCAGCACCCACTGG + Intronic
1186514535 X:10156785-10156807 AGACAGGACGCCCCACCCTCAGG - Intergenic
1187842646 X:23504927-23504949 CCCCAGGACTCCCCACCTCCAGG - Intergenic
1189348546 X:40260504-40260526 GCACAGGACTCAACACCCAATGG + Intergenic
1190138025 X:47815212-47815234 CCACATGAGTCCCCAACCAAGGG + Intergenic
1196551901 X:117038459-117038481 TCACAGGACTCACCTCCCAGGGG - Intergenic
1199643267 X:149882858-149882880 CCCCTGGACACCCCACCCAGTGG + Intronic
1199760185 X:150898882-150898904 ACCCAGGCCTCCCCACCCACCGG - Intergenic
1200979402 Y:9248214-9248236 CCACAGGCCTCTCATCCCACAGG + Intergenic