ID: 1019431657

View in Genome Browser
Species Human (GRCh38)
Location 7:1002306-1002328
Sequence CCACAGGATTCCCTACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 2, 2: 39, 3: 32, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431657_1019431671 17 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431671 7:1002346-1002368 TGGGGAGTCCTGTGGGTGAATGG 0: 1
1: 35
2: 9
3: 60
4: 292
1019431657_1019431664 -3 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431664 7:1002326-1002348 TGGGTGTGGAGCCCTGTGGGTGG No data
1019431657_1019431674 28 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431674 7:1002357-1002379 GTGGGTGAATGGAGTCCTGTGGG 0: 1
1: 38
2: 40
3: 14
4: 165
1019431657_1019431665 -2 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431665 7:1002327-1002349 GGGTGTGGAGCCCTGTGGGTGGG No data
1019431657_1019431662 -7 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431657_1019431663 -6 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG No data
1019431657_1019431670 10 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG No data
1019431657_1019431673 27 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431673 7:1002356-1002378 TGTGGGTGAATGGAGTCCTGTGG No data
1019431657_1019431666 -1 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431666 7:1002328-1002350 GGTGTGGAGCCCTGTGGGTGGGG 0: 3
1: 0
2: 15
3: 77
4: 514
1019431657_1019431669 9 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431669 7:1002338-1002360 CCTGTGGGTGGGGAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019431657 Original CRISPR CCACAGGATTCCCTACCCAC AGG (reversed) Intronic
903124118 1:21236174-21236196 CCAGAGCCTTCCCGACCCACGGG + Intronic
903445293 1:23418944-23418966 CCTCAAGATCCCCTCCCCACAGG + Intronic
903646024 1:24897019-24897041 CCCCAGGCTTCCCCAGCCACTGG + Intergenic
905361933 1:37426809-37426831 CCTCAGTAATCCCTACCCTCAGG + Intergenic
911048979 1:93653694-93653716 CCACAGTGTTTCCCACCCACTGG - Intronic
914245917 1:145885805-145885827 CCACAGGTTCCCGAACCCACCGG + Exonic
915302132 1:154957755-154957777 CCGCCGCATCCCCTACCCACAGG + Exonic
916503107 1:165403895-165403917 TCACAGCATTCCTCACCCACAGG + Intronic
919988072 1:202689647-202689669 CCACAGTGTTCCCTGCCCCCTGG - Intronic
923547489 1:234933339-234933361 CCAGAGGCTACCATACCCACAGG + Intergenic
924544396 1:245011644-245011666 ACTCAGGAATCCTTACCCACTGG - Intronic
1073045711 10:100637122-100637144 CCAGAAGATTCCCCACCCCCAGG + Intergenic
1076608680 10:131706664-131706686 ACACAGGAAGCCCTGCCCACAGG + Intergenic
1077562109 11:3270604-3270626 CCACAGTCTTCACAACCCACAGG - Intergenic
1077568003 11:3316424-3316446 CCACAGTCTTCACAACCCACAGG - Intergenic
1077880614 11:6346663-6346685 CCACAGGTTACCTTATCCACAGG - Intergenic
1080693893 11:34584176-34584198 TCACAGGACTCCCTCACCACGGG + Intergenic
1080992684 11:37558427-37558449 CCACAGTTTTCCCTTCCAACTGG - Intergenic
1087810844 11:102607830-102607852 CCACAGGAATCGCTTCCCATTGG + Intronic
1088081414 11:105920526-105920548 TCTCTGGAGTCCCTACCCACTGG + Intronic
1090024932 11:123159433-123159455 CCCCAGGCTTGCCTGCCCACAGG - Intronic
1092257299 12:6934335-6934357 CCACAGGATGCCCAAGGCACTGG + Intronic
1092477963 12:8835277-8835299 CCACAAGATTTCCTACCAAATGG + Intronic
1101757798 12:107635016-107635038 CCTCATGATTCGCTACCTACTGG - Intronic
1103923836 12:124413064-124413086 CCACAGGCTTCCCCTCCCTCGGG + Intronic
1104589624 12:130074059-130074081 CAACAGGATGCCCTTCCCAGAGG + Intergenic
1106623884 13:31398574-31398596 CCACAGCATGCCCTACCCACAGG + Intergenic
1113523222 13:110954867-110954889 CCACGGGCCTCCCTACCCTCGGG + Intergenic
1113702139 13:112395942-112395964 CCACGGGCCTCCCTACCCTCGGG - Intronic
1117114333 14:52494267-52494289 CCAAAGGAATGGCTACCCACGGG - Intronic
1117941722 14:60973974-60973996 TCACAGTATTCCCAACTCACAGG - Exonic
1119893136 14:78197946-78197968 GCACATGGTTCCCTACCCAGAGG + Intergenic
1120838633 14:89063357-89063379 CCACAGTATCCCCAAACCACTGG + Intergenic
1120997055 14:90425028-90425050 CCCCAGGATTCACCACCGACTGG - Intergenic
1122908427 14:104814190-104814212 CCACCGAGTTCCCTCCCCACAGG - Intergenic
1123587626 15:21773322-21773344 TCACTGGATTTTCTACCCACGGG - Intergenic
1123624264 15:22215887-22215909 TCACTGGATTTTCTACCCACGGG - Intergenic
1124587210 15:31020855-31020877 CCACAGGCCTCGCTTCCCACAGG - Intronic
1128107136 15:65053478-65053500 CTACAGGCTTCCCGACCCACAGG - Exonic
1129264837 15:74387999-74388021 CCCCAGAATTCCCTGCCCACAGG + Intergenic
1133026692 16:2991716-2991738 CCACAGGAGTCCCCACCCACAGG - Intergenic
1133221818 16:4322140-4322162 CCTCAGGATCCCCTGCCCCCTGG - Intronic
1133418967 16:5629437-5629459 CCACAGGGTCCCCTACAAACTGG - Intergenic
1134471486 16:14530255-14530277 CCACAGGAATCCCAAGCCCCAGG + Intronic
1135159906 16:20084873-20084895 CCACTGGATTGCCTACCTGCTGG - Intergenic
1135597299 16:23754563-23754585 CCCCAGGATTCCCTCCCCATAGG + Intergenic
1141040197 16:80666600-80666622 CGACAGGATTCCCTTCCCATTGG - Intronic
1142088474 16:88197446-88197468 CCACAGGATTAAATGCCCACAGG + Intergenic
1142962074 17:3557412-3557434 CCCCAGGATTCCCAAACCTCAGG + Intronic
1146655648 17:34633191-34633213 CCACTTGATTCCCTGCACACGGG - Intronic
1147917118 17:43895044-43895066 TCACTGCATTCCCTTCCCACAGG - Intronic
1148201721 17:45753825-45753847 CCACCTCAGTCCCTACCCACAGG - Intergenic
1149281224 17:55108015-55108037 CCACAGCAGTCCCTTCCCCCAGG + Intronic
1149571002 17:57672339-57672361 CCACAGGCCTCCCCACACACAGG + Intronic
1150500136 17:65643041-65643063 CTCCAGGATTCCCTGCCCACTGG + Intronic
1150836871 17:68572268-68572290 CCACAGCATTCAGCACCCACAGG + Intronic
1151110245 17:71667961-71667983 CCACATCATTCTCTACACACAGG - Intergenic
1152264648 17:79287307-79287329 CCATAGCACTCCCCACCCACAGG + Intronic
1154032355 18:10765110-10765132 CCTGAGGATTCCCTGCCCGCAGG + Intronic
1156391666 18:36656259-36656281 CAACAGGGTTCCCAAACCACAGG - Intronic
1158062525 18:53363145-53363167 CAAAAGCATTCCTTACCCACTGG + Intronic
1160456389 18:79005410-79005432 CCACAGGATTCCTTACCCAGTGG + Intergenic
1161723649 19:5916651-5916673 CCACAGGTGTCCCTGCCCCCAGG - Exonic
1162119294 19:8452650-8452672 CAACAGGCTTCCCTTCCCACGGG - Intronic
1162753576 19:12843634-12843656 CCCCTGAATTCCTTACCCACCGG - Intronic
1164632018 19:29768204-29768226 CCCCAGGCTGCCCTCCCCACAGG - Intergenic
1166996073 19:46720235-46720257 CCCCAGGAATCCCTCCCCAACGG - Exonic
1167371608 19:49085819-49085841 CCTCGTGGTTCCCTACCCACAGG + Intronic
925999475 2:9318888-9318910 CCACAGGTTTCCCTGCTCCCTGG - Intronic
927875269 2:26651025-26651047 CCACAGGCTTCCCTTCCCCCGGG - Intergenic
931464446 2:62474349-62474371 CCACAGCATTCCATGTCCACAGG + Intergenic
932037048 2:68256078-68256100 CCACAAGATTCCCTTCTCAGTGG + Intronic
932619559 2:73257740-73257762 CCACAGGATTCACTTTTCACTGG - Exonic
934060292 2:88286146-88286168 TCACAGCCTTCCCTACCCACTGG - Intergenic
935178927 2:100673353-100673375 CCCCAGCATTCCCTGCCCACAGG - Intergenic
935181372 2:100693656-100693678 CCACAGCCTTCCCAACCCCCAGG - Intergenic
936733649 2:115413235-115413257 CCACAGGTTTCTCTACCAAATGG + Intronic
936750542 2:115635688-115635710 CCACAAGCTTCCCTCCCCATTGG - Intronic
939630604 2:144523301-144523323 CCTCAGGATTCCCTCCACCCAGG + Intronic
942994900 2:182249296-182249318 CCCCAGCATTCTCTACCCAAAGG - Intronic
944168622 2:196750380-196750402 CCCCAGGATTCTGTGCCCACTGG + Intronic
944881657 2:204018920-204018942 CCACAGGCTCCCCTGCCCGCTGG - Intergenic
946061444 2:216944978-216945000 CCCCAGGATTCCCATACCACAGG - Intergenic
948992511 2:241562048-241562070 TCGCAGGATTCCCGCCCCACCGG + Intronic
1170017496 20:11798100-11798122 CCACAAGAGTCTCTCCCCACAGG + Intergenic
1171493507 20:25538470-25538492 TCAAAGGATTCCTTACCCAGAGG - Intronic
1172481603 20:35274909-35274931 CCACAGGATGCCGTGACCACAGG - Exonic
1173742193 20:45408657-45408679 CCACAAGATTCAGGACCCACAGG - Intronic
1175502433 20:59460087-59460109 CCACAGGCTCCCCTACACTCAGG + Intergenic
1177578896 21:22994183-22994205 CCACAGCAAGCCCCACCCACGGG + Intergenic
1181635037 22:24170570-24170592 CCACAGGATGGGCTGCCCACAGG + Intronic
1182409115 22:30167423-30167445 CCACAGGAATCCCTAACTCCAGG - Intronic
1182817723 22:33180944-33180966 CAAAAGGATTCCGTACCCACTGG - Intronic
1184531955 22:45061881-45061903 CCACAGGATTCCCCAGCTCCGGG - Intergenic
949624164 3:5849015-5849037 CTTCAGGATTCCCTGCCCAGGGG + Intergenic
953475933 3:43205950-43205972 CAAAAGCATTCCCCACCCACTGG + Intergenic
954494961 3:50949086-50949108 CCAAAGGATTCCCTAACCTTAGG + Intronic
955918095 3:63926518-63926540 CCACAGCATTCTCTCCACACTGG - Intronic
962898605 3:139737529-139737551 CCCCAGGAATCCCTAGGCACTGG + Intergenic
966928877 3:184662990-184663012 CCATAAGATTCCCTCCCCGCAGG - Intronic
968691372 4:1992069-1992091 CCCCAGGATTTCCCACCCGCAGG - Intronic
970772621 4:19633564-19633586 CCACAGAATTCCCTACAATCTGG - Intergenic
970792221 4:19871901-19871923 CCACAGGTTGCCCCAGCCACAGG - Intergenic
972312724 4:37895917-37895939 CCACAGGATTCCACCCCAACGGG - Intronic
972754178 4:42027665-42027687 TCACAGTATTCCCAACTCACAGG + Intronic
973264126 4:48194114-48194136 CCACAGGGTTTCCCACCCTCAGG - Intronic
978591832 4:110331925-110331947 CCACAAGAATCCCTGCCCTCGGG - Intergenic
979601065 4:122586986-122587008 CCACATATTTACCTACCCACAGG - Intergenic
984590583 4:181613294-181613316 CCAAAGGATTCCTTCCCCTCGGG + Intergenic
985998834 5:3614018-3614040 TCACAGGATGCTCTACCTACAGG + Intergenic
988713544 5:33802473-33802495 CCACAGGATGGACCACCCACTGG + Intronic
994075035 5:95641021-95641043 CCCCTTGATTCCCTTCCCACTGG - Intergenic
995071364 5:107925618-107925640 CCTCAGGATTGTCTACCCAAAGG - Intronic
995372622 5:111436412-111436434 CCCCTGGATTCCCTACCCAGAGG + Intronic
996450691 5:123620103-123620125 TCACAATATTCCCAACCCACAGG - Intergenic
997372118 5:133368725-133368747 CTACAGGAATGACTACCCACCGG - Intronic
999091704 5:148941833-148941855 TCCCAGGATTCCTTGCCCACTGG + Intronic
1000338649 5:160260489-160260511 CCTCAGGTTATCCTACCCACGGG + Intronic
1004910764 6:20280597-20280619 CCCCAGGATCCCATATCCACAGG - Intergenic
1004927676 6:20431543-20431565 CCACTGGCTTCCATTCCCACTGG - Intronic
1006108579 6:31730726-31730748 CTCCAGGATTCCCTGCCCACTGG + Exonic
1011030089 6:82913046-82913068 CCACTGGATTGCATAGCCACTGG - Intronic
1013551218 6:111209615-111209637 CCACAGGCTTCCTAACCCACAGG - Intronic
1013596022 6:111661885-111661907 CTACAGGATGCCCTGCCCGCAGG - Exonic
1017235096 6:152110871-152110893 CCTCAAGCTTCCCTACCCAACGG - Intronic
1018520628 6:164646437-164646459 CCACAGTGTTCCCTGCCCAAAGG + Intergenic
1019431370 7:1001338-1001360 CCACAGGGCTCCACACCCACAGG - Intronic
1019431377 7:1001354-1001376 CCACAGGACTCCCCACCCACAGG - Intronic
1019431387 7:1001388-1001410 CCACAGGACTCCCCACCCACAGG - Intronic
1019431397 7:1001422-1001444 CCACAGGAATCCCCACCCACAGG - Intronic
1019431407 7:1001456-1001478 CCACAGGACTCCCCACCCACAGG - Intronic
1019431425 7:1001526-1001548 CCACAGGACTCCCCACCCACAGG - Intronic
1019431436 7:1001560-1001582 CCACAGGACTCCCCACCCACAGG - Intronic
1019431460 7:1001626-1001648 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431474 7:1001678-1001700 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431480 7:1001694-1001716 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431490 7:1001728-1001750 CCACAGGACTCCCCACCCACAGG - Intronic
1019431504 7:1001780-1001802 CCACAGGACTCCCCACCCACAGG - Intronic
1019431509 7:1001796-1001818 CCACAGGACTCCCTACCCACAGG - Intronic
1019431513 7:1001812-1001834 CCACAGGGCTCCACACCCACAGG - Intronic
1019431520 7:1001828-1001850 CCACAGGACTCCCCACCCACAGG - Intronic
1019431530 7:1001862-1001884 CCACAGGACTCCCCACCCACAGG - Intronic
1019431540 7:1001896-1001918 CCGCAGGACTCCCCACCCACAGG - Intronic
1019431546 7:1001912-1001934 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431552 7:1001928-1001950 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431566 7:1001980-1002002 CCACAGGACTCCCCACCCACAGG - Intronic
1019431576 7:1002014-1002036 CCACAGGACTCCCCACCCACAGG - Intronic
1019431586 7:1002048-1002070 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431592 7:1002064-1002086 CCAGAGGACTCCCCACCCACAGG - Intronic
1019431601 7:1002098-1002120 CCACAGGACTTCCCACCCACAGG - Intronic
1019431619 7:1002168-1002190 CCACAGGACTCCCCACCTGCAGG - Intronic
1019431625 7:1002184-1002206 CCACAGGACTCCCCACCCACAGG - Intronic
1019431652 7:1002290-1002312 CCACAGGACTCCCCACCCACAGG - Intronic
1019431657 7:1002306-1002328 CCACAGGATTCCCTACCCACAGG - Intronic
1019431661 7:1002322-1002344 CCACAGGGCTCCACACCCACAGG - Intronic
1019431668 7:1002338-1002360 CCACAGGACTCCCCACCCACAGG - Intronic
1019431678 7:1002372-1002394 CCACAGGACTCCCCACCCACAGG - Intronic
1019431687 7:1002406-1002428 CCACAGGACTCCCCACCGGCAGG - Intronic
1019431694 7:1002422-1002444 CCACAGGACTCCCCACCCACAGG - Intronic
1019431708 7:1002474-1002496 CCACAGGACTCCCCACCCACAGG - Intronic
1019431718 7:1002508-1002530 CCACAGGACTCCCCACCCACAGG - Intronic
1019431747 7:1002614-1002636 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431753 7:1002630-1002652 CCGCAGGACTCCCCACCCACAGG - Intronic
1019431781 7:1002736-1002758 CCACAGGACTCCCCACCCACAGG - Intronic
1019431788 7:1002752-1002774 CCCAAGGACTCCCCACCCACAGG - Intronic
1019431801 7:1002803-1002825 CCACAGGACTCCCCACCCACAGG - Intronic
1019431811 7:1002837-1002859 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431822 7:1002871-1002893 CCCAAGGACTCCCCACCCACAGG - Intronic
1019431829 7:1002904-1002926 CCACAGGACTCCAAACCCACAGG - Intronic
1019431834 7:1002920-1002942 CCACAGGACTCCCTACCCACAGG - Intronic
1019431852 7:1002990-1003012 CCACAGGACTCCCCACCCACAGG - Intronic
1019431862 7:1003024-1003046 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431872 7:1003058-1003080 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431886 7:1003110-1003132 CCACAGGACTCCCCACCCACAGG - Intronic
1019431896 7:1003144-1003166 CCACAGGACTCCCCACCCACAGG - Intronic
1019431906 7:1003178-1003200 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431920 7:1003230-1003252 CCACAGGACTCCCCACCCACAGG - Intronic
1019431946 7:1003336-1003358 CCACAGGACTCCCCACCCACAGG - Intronic
1019431952 7:1003352-1003374 CCACAGGACTCCCCACCCACAGG - Intronic
1019431966 7:1003404-1003426 CCACAGGACTCCCCACCCACAGG - Intronic
1019431976 7:1003438-1003460 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019431990 7:1003490-1003512 CCACAGGACTCCCCACCCACAGG - Intronic
1019431997 7:1003506-1003528 CCCAAGGACTCCCCACCCACAGG - Intronic
1019432010 7:1003557-1003579 CCACAGGACTCCCCACCCACAGG - Intronic
1019432016 7:1003573-1003595 CCACAGGACTCCCCACCCACAGG - Intronic
1019432026 7:1003607-1003629 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432036 7:1003641-1003663 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432045 7:1003675-1003697 CCACAGGACTCCCCACCCACAGG - Intronic
1019432055 7:1003709-1003731 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432070 7:1003761-1003783 CCCAAGGACTCCCCACCCACAGG - Intronic
1019432077 7:1003794-1003816 CCACAGGACTCCAAACCCACAGG - Intronic
1019432083 7:1003810-1003832 CCACAGGACTCCCCACCCACAGG - Intronic
1019432095 7:1003862-1003884 CCACAGGACTCCAAACCCACAGG - Intronic
1019432101 7:1003878-1003900 CCACAGGACTCCCCACCCACAGG - Intronic
1019432115 7:1003930-1003952 CCACAGGACTCCCCACCCACAGG - Intronic
1019432129 7:1003982-1004004 CCACAGGACTCCCCACCCACAGG - Intronic
1019432139 7:1004016-1004038 CCGCAGGACTCCCCACCCGCAGG - Intronic
1019498643 7:1353127-1353149 CCACCGCCTTCCCCACCCACTGG + Intergenic
1020021497 7:4872137-4872159 CCACACGAGCCCCTGCCCACTGG - Intronic
1021798671 7:24283783-24283805 CAACAGGACTACCAACCCACTGG - Intergenic
1031149555 7:118037259-118037281 TCCCAGGATTCCATACCAACTGG - Intergenic
1036678540 8:10853810-10853832 CCACAGGGCTCCCCACTCACAGG - Intergenic
1038007529 8:23445321-23445343 CCCCACCATTCCCTACCCAAAGG + Intronic
1040618375 8:49062706-49062728 GCACAGGATGCCCTGCACACAGG + Intronic
1045289653 8:100821500-100821522 CCACAGAATTCCTTACGCCCTGG - Intergenic
1046137689 8:110051033-110051055 TCATAAGATTCCCTGCCCACAGG - Intergenic
1050943210 9:11485917-11485939 CCACGGTCTTCCCAACCCACAGG - Intergenic
1051191186 9:14515234-14515256 CCATCTGATTCCCTGCCCACGGG - Intergenic
1053163368 9:35828830-35828852 CCTCAGGAGACCTTACCCACCGG - Intronic
1058785432 9:108381911-108381933 CCACAGGTTTCAGTATCCACAGG + Intergenic
1059706096 9:116824972-116824994 CTACAGGATTCCCTTCCTAGAGG - Intronic
1060402084 9:123355106-123355128 CAAGAGGATTCTCTCCCCACTGG + Intergenic
1060848619 9:126857232-126857254 CCACAGGATTCTCTACTGCCCGG + Intergenic
1061014555 9:127974304-127974326 CCTCAGGAGTACCTACCCAGGGG - Intronic
1061333739 9:129915168-129915190 CCACAGTCTTCCATTCCCACAGG + Intronic
1061900722 9:133670752-133670774 CCCATGGATTCCCTTCCCACAGG - Exonic
1185459353 X:327761-327783 TCACTGGATTTTCTACCCACGGG + Intergenic
1189792933 X:44620676-44620698 TCACAGGCTTCTCTAACCACAGG - Intergenic
1190562190 X:51696713-51696735 CCACTGGATGCCAGACCCACTGG + Intergenic
1195067095 X:101247518-101247540 CCACACTGTTCCCTAACCACTGG - Intronic
1197319151 X:125006409-125006431 CTGCAGGCTTCCCTCCCCACAGG - Intergenic