ID: 1019431662

View in Genome Browser
Species Human (GRCh38)
Location 7:1002322-1002344
Sequence CCTGTGGGTGTGGAGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019431657_1019431662 -7 Left 1019431657 7:1002306-1002328 CCTGTGGGTAGGGAATCCTGTGG 0: 1
1: 2
2: 39
3: 32
4: 147
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431652_1019431662 9 Left 1019431652 7:1002290-1002312 CCTGTGGGTGGGGAGTCCTGTGG 0: 35
1: 20
2: 20
3: 27
4: 282
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431645_1019431662 28 Left 1019431645 7:1002271-1002293 CCCTGTGGGTGAGTGGAATCCTG 0: 2
1: 4
2: 3
3: 12
4: 137
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data
1019431646_1019431662 27 Left 1019431646 7:1002272-1002294 CCTGTGGGTGAGTGGAATCCTGT 0: 3
1: 37
2: 34
3: 14
4: 134
Right 1019431662 7:1002322-1002344 CCTGTGGGTGTGGAGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019431662 Original CRISPR CCTGTGGGTGTGGAGCCCTG TGG Intronic
No off target data available for this crispr