ID: 1019433139

View in Genome Browser
Species Human (GRCh38)
Location 7:1008603-1008625
Sequence CAGCCTCAGCTCCGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019433131_1019433139 19 Left 1019433131 7:1008561-1008583 CCACCCAACGCTATGGCTGAGCT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG No data
1019433130_1019433139 25 Left 1019433130 7:1008555-1008577 CCGGATCCACCCAACGCTATGGC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG No data
1019433128_1019433139 29 Left 1019433128 7:1008551-1008573 CCAGCCGGATCCACCCAACGCTA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG No data
1019433132_1019433139 16 Left 1019433132 7:1008564-1008586 CCCAACGCTATGGCTGAGCTCAT 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG No data
1019433133_1019433139 15 Left 1019433133 7:1008565-1008587 CCAACGCTATGGCTGAGCTCATT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019433139 Original CRISPR CAGCCTCAGCTCCGAGAAAC AGG Intronic
No off target data available for this crispr