ID: 1019433445

View in Genome Browser
Species Human (GRCh38)
Location 7:1010252-1010274
Sequence CTGTCCCCAAGCACTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019433438_1019433445 7 Left 1019433438 7:1010222-1010244 CCACCCTCACCTCAGTAGTGGCC 0: 1
1: 0
2: 4
3: 19
4: 200
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433434_1019433445 14 Left 1019433434 7:1010215-1010237 CCCGAGCCCACCCTCACCTCAGT 0: 1
1: 1
2: 3
3: 39
4: 413
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433437_1019433445 8 Left 1019433437 7:1010221-1010243 CCCACCCTCACCTCAGTAGTGGC 0: 1
1: 0
2: 0
3: 19
4: 162
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433435_1019433445 13 Left 1019433435 7:1010216-1010238 CCGAGCCCACCCTCACCTCAGTA 0: 1
1: 0
2: 6
3: 24
4: 406
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433439_1019433445 4 Left 1019433439 7:1010225-1010247 CCCTCACCTCAGTAGTGGCCAAA 0: 1
1: 0
2: 0
3: 19
4: 125
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433440_1019433445 3 Left 1019433440 7:1010226-1010248 CCTCACCTCAGTAGTGGCCAAAA 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433433_1019433445 24 Left 1019433433 7:1010205-1010227 CCTGGGGCTTCCCGAGCCCACCC 0: 1
1: 0
2: 1
3: 41
4: 340
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211
1019433441_1019433445 -2 Left 1019433441 7:1010231-1010253 CCTCAGTAGTGGCCAAAAGCTCT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG 0: 1
1: 1
2: 0
3: 28
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019433445 Original CRISPR CTGTCCCCAAGCACTGGGTC TGG Intronic
900872901 1:5317383-5317405 CTGTCCCCAAACTCTGGATTGGG + Intergenic
902206221 1:14870090-14870112 CTGTCCAGGAGCACTGGGCCTGG + Intronic
902404660 1:16175989-16176011 TTGTCCCCAGACACTGGCTCAGG - Intergenic
902439180 1:16418093-16418115 TTCTCTCCAAGCACTGGGCCTGG + Intronic
902514338 1:16981635-16981657 CTGCCCCCAGTCACTGAGTCAGG - Intergenic
902688558 1:18095252-18095274 CAGCCCCCAGGCCCTGGGTCAGG - Intergenic
903026000 1:20430412-20430434 CTGTCCCCAAGGACTGAGGATGG - Intergenic
904287473 1:29461619-29461641 CTGTTCCCAGACACTGGGTCAGG + Intergenic
904370733 1:30045985-30046007 CTGTTCCCAGACACTGGGTCAGG + Intergenic
904398829 1:30242210-30242232 CTGTGCACCAGCACTGTGTCAGG - Intergenic
904417589 1:30372713-30372735 CTGTCCCTAGGCACTGGGCCAGG - Intergenic
904435435 1:30491927-30491949 CTGTCAGCAAGAGCTGGGTCTGG - Intergenic
905476718 1:38233893-38233915 ATGTCCAAAAGCACTGAGTCAGG - Intergenic
906202848 1:43971173-43971195 CTGTGCCCATGCCCTGGGTAAGG + Exonic
906382802 1:45343454-45343476 CCATCCCCAGGCACTGGGTTAGG - Exonic
906935710 1:50212442-50212464 CTGAACCCAGGAACTGGGTCAGG - Intergenic
907238631 1:53068376-53068398 GTGGCCACAAGCACTGGCTCAGG - Intronic
907491836 1:54813604-54813626 CTTTCCCCAACCAGCGGGTCGGG - Intronic
910892101 1:92029256-92029278 CTTTTCCCAATCACCGGGTCAGG - Intergenic
911761190 1:101619213-101619235 CTGTCCACAAGCCTGGGGTCTGG + Intergenic
913529941 1:119726728-119726750 ACTTCCCCAAGAACTGGGTCTGG - Intronic
914922047 1:151853753-151853775 CCCTCCCCAAGCACTGGGTGGGG - Intergenic
916018224 1:160769427-160769449 CTGTCCTCAGTCACTGAGTCAGG - Intergenic
918117243 1:181507992-181508014 CAGTCCCCAAGAGCTGGGGCAGG - Intronic
919789897 1:201284224-201284246 CTGTCCCTGAGCCCTGGGTCTGG + Intronic
922777096 1:228219975-228219997 CCGTCCCCACACACTGAGTCTGG - Intronic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1063568942 10:7196844-7196866 CTGTCTCCAAGCACTGTCTGAGG + Intronic
1067208841 10:44242024-44242046 CTGACCCCAAGCCCTTGGGCAGG - Intergenic
1067216194 10:44306160-44306182 CCTTCCCCAACCACTGGGCCTGG + Intergenic
1068578747 10:58714507-58714529 CTGTCCCCCAGCACTGAAGCAGG - Intronic
1072674234 10:97453719-97453741 CTGTCCCTAAGGAATGGGGCTGG + Intronic
1073293576 10:102425238-102425260 CTGCCCCCACCCACTGGGCCTGG + Intronic
1074599757 10:114901632-114901654 CTGTCCCCATGCCTTGGTTCAGG + Intergenic
1075370195 10:121928568-121928590 GTGTCCCCAAGCCCTGCGTTTGG + Intronic
1079126423 11:17721174-17721196 CTGTCTCAAAGTACTGGGCCCGG + Intronic
1079514308 11:21248794-21248816 CTGGCCACAAGGACTGGTTCAGG + Intronic
1080462011 11:32463012-32463034 CTATCACCTAGCACAGGGTCTGG + Intergenic
1084212649 11:67630974-67630996 TGGTCCCCAAGCCCAGGGTCTGG - Intergenic
1085531728 11:77195702-77195724 CTGTCCCAGAGCCCTGGGCCAGG + Intronic
1086079941 11:82893058-82893080 CTGTACCCAATCACAGGGTAGGG - Intronic
1087123378 11:94598420-94598442 CTCTCCCCAAGTACTATGTCTGG - Intronic
1089893970 11:121908790-121908812 CTGTCATCAAGCACTGGTCCAGG - Intergenic
1089986063 11:122815311-122815333 CTGTCCCAAAGCACAGGATGAGG - Intergenic
1090449794 11:126796393-126796415 CTGTCCCGCAGCATTGGGTGTGG + Intronic
1092743923 12:11655418-11655440 CTGTCCCCAAATACTAGGTTTGG - Intronic
1096071973 12:48780474-48780496 CTGGCCCCAAGGACTGGCACAGG + Intronic
1101994087 12:109512181-109512203 CTGCCCCCATGGACTGGGTGAGG + Intronic
1105045151 12:132997019-132997041 CGGTCTAGAAGCACTGGGTCTGG - Intronic
1105813491 13:24013451-24013473 CTGTCCCCAAGCAGTGTCCCAGG - Intronic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1105948558 13:25210029-25210051 CTGTCCCTCAGGTCTGGGTCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106367721 13:29099254-29099276 CTTTTCCCAAGCACTAGGACAGG + Intronic
1107535389 13:41324516-41324538 CAGGCCCCCACCACTGGGTCTGG + Intronic
1110470327 13:75853121-75853143 CTGTCTCCAAGAATTGGATCGGG - Exonic
1112656941 13:101461551-101461573 CAGTCACCCACCACTGGGTCTGG - Intronic
1113814316 13:113161123-113161145 CTCTCCCCAAGGACCAGGTCAGG + Intronic
1118310147 14:64686026-64686048 CTGTACCCGAGCTCTGGGCCTGG + Intergenic
1118316122 14:64727184-64727206 CTGTGCCCCAGCAGTGGGGCTGG + Intronic
1118565948 14:67141169-67141191 CTGTCCACAAGCTCTGACTCTGG - Intronic
1121244275 14:92451076-92451098 CTGCCCCCAAGCACTGGGGAAGG + Intronic
1121338690 14:93092479-93092501 CTGTTTCCAGGCAGTGGGTCAGG - Intronic
1121854692 14:97256456-97256478 ATGCCCCCCAGCACTGGGCCAGG - Intergenic
1122099972 14:99400376-99400398 CTGTCCCTACGCAATGGGCCAGG + Intronic
1122191468 14:100047374-100047396 CTGTACCCAAGCACAGAGCCTGG + Intronic
1122541434 14:102499765-102499787 CTGACACCAAGGACTGGGCCTGG - Exonic
1123436118 15:20255806-20255828 CTCACCCACAGCACTGGGTCTGG + Intergenic
1125796305 15:42406475-42406497 CTGACCCCAAGCACAGTGCCTGG - Intronic
1126898554 15:53286648-53286670 CTGCACCCAAGCACTTGGGCCGG - Intergenic
1128053311 15:64682086-64682108 CCACCCCCAAGCACTGGGTAAGG + Exonic
1128145965 15:65332718-65332740 CTGTCCCCATGCACTGGGCTTGG - Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1130670184 15:85905284-85905306 CTGTGCCCAGTCACTGAGTCTGG + Intergenic
1132205517 15:99983673-99983695 CTGTCTCCCCGCACTGGGTCTGG + Intronic
1132746700 16:1439223-1439245 CTGTCCCCAAGCCCTGAGCCCGG + Intronic
1133976789 16:10604921-10604943 CTGTCCCCAATCTATGGGTCAGG + Intergenic
1134225052 16:12383274-12383296 CTGTTGCCAAGCACTGGGATAGG + Intronic
1134240962 16:12506369-12506391 CTGTCCCCAACTACTTGGTCTGG + Intronic
1135114182 16:19711744-19711766 CGGACACCAAGCCCTGGGTCAGG - Intronic
1136622741 16:31441219-31441241 GTGGCCCGAAGCACTGGGCCGGG - Intronic
1136848484 16:33595183-33595205 CTCACCCACAGCACTGGGTCTGG - Intergenic
1137979759 16:53059604-53059626 CTGCCCCCAAATACTAGGTCTGG + Intronic
1138576154 16:57908524-57908546 CTGTGCCCAGGCACTGAGGCAGG + Intronic
1138659682 16:58509718-58509740 CTGACCCCAAGCCCTGGGGCGGG - Intronic
1139203627 16:65004643-65004665 CTGCCCACAAGCACGGGGTCAGG + Exonic
1139552852 16:67685298-67685320 CCCTCCCCAAGCACTGCTTCAGG + Intronic
1140906629 16:79414931-79414953 GTGTCCCCAATCACTGAGGCAGG + Intergenic
1141274032 16:82568776-82568798 CTGTACCCCAGCACAGTGTCTGG + Intergenic
1203110191 16_KI270728v1_random:1443832-1443854 CTCACCCACAGCACTGGGTCTGG - Intergenic
1142910723 17:3088764-3088786 CTGTCACCACGCCCTGGGCCTGG - Intergenic
1143189718 17:5032764-5032786 CTGTCCCCTGGCTCTGGGCCTGG + Exonic
1143409642 17:6701177-6701199 CCGTCCCCACGCACAGGGCCAGG - Intronic
1143718834 17:8796219-8796241 CTGTGCCCAGGCACTTGGTGGGG - Intergenic
1144673168 17:17144290-17144312 CAGCCCCCAAGCCCTGGGGCAGG - Intronic
1146449242 17:32959332-32959354 CTGACTCCAAGCAGTGGGTTGGG + Intergenic
1146660385 17:34661622-34661644 CTGTGCCCTAGCACTGGGAGTGG + Intergenic
1147039554 17:37707911-37707933 CTTTCCCCAAGGACTGGTTTTGG - Intronic
1147767945 17:42849417-42849439 TTGTCTCCAAGGACTGGGGCAGG - Intronic
1151255309 17:72872134-72872156 CCCTCCCCAGGCACTGGGACAGG - Intronic
1151261203 17:72917294-72917316 CAGGCGCCAAGCACTGTGTCTGG + Intronic
1151320934 17:73352040-73352062 CTGCACCCAGGCACTAGGTCAGG + Intronic
1152224470 17:79086273-79086295 CTGTCCCCAAGGAAGGGTTCCGG + Exonic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1156479294 18:37426143-37426165 CTGCCCCCAAGCACAGGTCCTGG + Intronic
1157782719 18:50454338-50454360 CCATCCCCAAACACTGGATCAGG + Intergenic
1158933302 18:62341984-62342006 CAGTCCCCAAGAACTGAGTTGGG - Intronic
1160821151 19:1058810-1058832 CTGTCCCCAGGCCCAGGGTGAGG + Exonic
1161272760 19:3399014-3399036 CTCTGCCCAAGCACTGGGCGTGG - Intronic
1162033598 19:7927594-7927616 CTGTCCCCAAGATCTGTGTGTGG - Intronic
1164634486 19:29782234-29782256 CTGCCTCCAGGCAGTGGGTCCGG + Intergenic
1164908661 19:31987771-31987793 CTGTTCCCACTCACCGGGTCAGG + Intergenic
1166618236 19:44270818-44270840 CTCTCCTGAATCACTGGGTCTGG - Intronic
1167476922 19:49706557-49706579 AGGTCCCAAAGCACTGGGTCTGG - Intronic
1167751041 19:51380398-51380420 GAGTCCCACAGCACTGGGTCAGG - Intronic
1168314688 19:55479517-55479539 CAGTCCACGGGCACTGGGTCAGG + Intronic
1168315534 19:55483284-55483306 CTGGCCCCAAGCTCGGGGCCTGG - Exonic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
927234252 2:20855937-20855959 CCTTGCCCAGGCACTGGGTCTGG - Intergenic
927325762 2:21803198-21803220 CTGTCACCAAGCACAGGGTGTGG + Intergenic
927653913 2:24929402-24929424 CTGTCTCAAAACACTGTGTCAGG + Intergenic
928595458 2:32855472-32855494 CTGACTCCAAACACTGAGTCAGG - Intergenic
929610188 2:43265234-43265256 TTGTCCAGATGCACTGGGTCTGG - Intronic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
929856990 2:45645914-45645936 CCTTCCCCAACCACAGGGTCTGG - Intergenic
929995670 2:46824998-46825020 CTGACCCCCAGTACTGAGTCAGG + Intronic
931648953 2:64451845-64451867 AAGTCCCCAAGTACTGGGGCTGG - Intergenic
932296897 2:70632239-70632261 CTGTCTCCCAGGAATGGGTCTGG - Intronic
932380283 2:71276247-71276269 GTGTCCCCAAGCACTGTGGCTGG + Intergenic
932463447 2:71898037-71898059 CTGCCCCCAAGTGCTGGGTTTGG - Intergenic
933057043 2:77683394-77683416 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
933927175 2:87104537-87104559 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
935651501 2:105386162-105386184 CTGCCCACAAGCACTGGGTGAGG - Intronic
941506946 2:166357931-166357953 CTCTCCCCAAACAATGTGTCAGG + Intronic
945984559 2:216343038-216343060 CTGTCCCAAAGGACTGGGACTGG + Intronic
947712170 2:232322473-232322495 CCCTCCCCATGCACTGGGTGTGG + Intronic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
948779501 2:240310170-240310192 CTGTCCCCAAGCACAGAGTAGGG + Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1172118847 20:32585911-32585933 CTGTCCCAGAGCAGTGGGGCAGG - Intronic
1172120962 20:32598513-32598535 CTGACACCCAGCACTGGGCCTGG + Intronic
1172954787 20:38748521-38748543 CCGGCCTCCAGCACTGGGTCCGG - Exonic
1174731637 20:52923750-52923772 CTGTCCCCAAGCACTGCCAAGGG + Intergenic
1175858189 20:62133921-62133943 CTGTCCCGAGGCGCTGGGTGGGG - Intronic
1179610426 21:42546652-42546674 CTGTCCCCAGTCACTCGGCCTGG - Intronic
1179641120 21:42747710-42747732 CTGGCCCCCAGCACTGTGCCAGG + Intronic
1180056500 21:45361746-45361768 GGGACCCCAAGCACTGGCTCTGG - Intergenic
1183386215 22:37516257-37516279 CTGTCATCAAGAATTGGGTCAGG + Exonic
1183677333 22:39306938-39306960 CGGGCCCCAGGCACTGGGCCAGG - Intergenic
1183902965 22:41020274-41020296 CTGTCCCCCAGCTCTGGGGAGGG - Intergenic
1183904705 22:41031742-41031764 CTTTCCCCTAGCACAGGGTTGGG + Intergenic
1184836075 22:47021815-47021837 CTGAACCCCAGCACTGGGGCGGG - Intronic
1185068062 22:48641791-48641813 CACTCCCCAAGCACTCGGCCTGG + Intronic
950512410 3:13439057-13439079 TTGTGCCCAAGTTCTGGGTCAGG - Intergenic
953387720 3:42516147-42516169 CTTACCCCAAGCTCTGGGTTGGG + Intronic
955676373 3:61453185-61453207 CTGTCCCCTAGCACTGTCCCTGG + Intergenic
956794429 3:72705001-72705023 CTGACCCCAAGGATTGGTTCAGG - Intergenic
961302828 3:125933244-125933266 CTGTCCCCGGCCACTGGGTGGGG - Intronic
963073478 3:141324377-141324399 TTTTCCCCAAGAACTGGCTCTGG - Intronic
965241675 3:166208440-166208462 CTGTCTCCTTGCACTGGATCAGG + Intergenic
967298246 3:187986609-187986631 CTGTCTCCCCGCACTGTGTCAGG - Intergenic
967736435 3:192957500-192957522 CTGTCCACAAGCACAGACTCTGG + Intergenic
968323501 3:197791706-197791728 CTCTCCCCAGGCTCTGGGTCTGG - Intronic
968391728 4:198397-198419 GTGGGCCCAGGCACTGGGTCTGG - Intergenic
968405272 4:335535-335557 GTGGGCCCAGGCACTGGGTCTGG - Intergenic
968907746 4:3462514-3462536 CTGTCCCCAAGCTCTGGCCTGGG - Intergenic
968931821 4:3584447-3584469 CAGTGCCCAAGTACTTGGTCAGG + Intronic
972365669 4:38372086-38372108 CAGTCCCCCAGCACTGCTTCTGG + Intergenic
978643617 4:110901550-110901572 CTGGCACCAAGCACTGGGCCTGG + Intergenic
979626108 4:122847396-122847418 CTGACCCCATGGACTGGGTTTGG + Intronic
984879360 4:184396975-184396997 CTGTACCCAAGCACTGAGCATGG + Intronic
985774434 5:1833534-1833556 AGGTTCTCAAGCACTGGGTCAGG - Intergenic
985861109 5:2471366-2471388 CTGTCCCCCAGCACCTTGTCAGG + Intergenic
986010434 5:3709785-3709807 CTGTGCCAAGGCAGTGGGTCAGG + Intergenic
987019322 5:13853051-13853073 CTGTCAGGAAGCACGGGGTCAGG - Intronic
989096580 5:37787453-37787475 GTCTCCCCAAGCTCTGGGCCAGG - Intergenic
991450099 5:66742546-66742568 CAGCCCCCAAGGACTGGGTGGGG - Intronic
992269701 5:75052733-75052755 CTGTCCCGAAGCCCAGGGGCGGG + Intergenic
992633378 5:78702883-78702905 CTGACCCTAAGGACTGGGGCTGG + Intronic
993176026 5:84486750-84486772 CTGTTACCAAGCACAGTGTCTGG + Intergenic
994320313 5:98387180-98387202 CAGTTCCCAAGCACTGGAACGGG + Intergenic
996471930 5:123871326-123871348 CTGTCCCAAGGCACTGGAGCTGG + Intergenic
998339739 5:141406273-141406295 GTTTCCCAAAGCACTGGGTGAGG + Intronic
998507247 5:142681872-142681894 CTGTGCCCAAGCACTGTGCTTGG - Intronic
1000501655 5:162058680-162058702 CTGTCACCTAGCACTCAGTCTGG + Intergenic
1001732419 5:173970140-173970162 CTGTCCCTAGGGCCTGGGTCAGG - Intergenic
1001879820 5:175233631-175233653 CTGACCTCCAGCACAGGGTCTGG + Intergenic
1002171737 5:177378505-177378527 CAGCTCCCCAGCACTGGGTCAGG - Intergenic
1003112962 6:3264353-3264375 CTGGCCACAGGCACTGGGGCTGG - Intronic
1003505619 6:6737787-6737809 CTGTCCCTAATCACTGTGTGTGG + Intergenic
1007383387 6:41504432-41504454 CTGTCCCCAAGCCCAGGCTTAGG + Intergenic
1007699774 6:43759753-43759775 CTGGCCCCAGGCACTGGGGAGGG - Intergenic
1009638238 6:66295220-66295242 CTGTCCCTCAGAACTGGGTGTGG + Intergenic
1017007353 6:150037782-150037804 CTGTCCCCGAGCTCTGGACCCGG + Intergenic
1018116940 6:160595420-160595442 CTGTCACCAGGCATTGTGTCAGG + Exonic
1018409649 6:163531223-163531245 CTGTCCCCAAGATGTGGGCCTGG + Intronic
1018723068 6:166588563-166588585 CTGTCCCCAACCTCTCGCTCTGG + Intronic
1019035876 6:169058275-169058297 AGGTCCCTAAGCACGGGGTCTGG + Intergenic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1020211263 7:6159650-6159672 CTGTCCCCAAGCGCGTGGCCTGG - Intronic
1022205209 7:28157259-28157281 CTGGCCTCAAGCACTGAGTCAGG + Intronic
1022691179 7:32656778-32656800 CTGTCCCCCAGGTCTGGGTAGGG + Intergenic
1026889554 7:73974070-73974092 ATGTCCCAAACCACAGGGTCTGG + Intergenic
1029371638 7:100154566-100154588 CTGTCCCCAACCCCTGAGACAGG + Exonic
1029611994 7:101631338-101631360 CTGACCCCAAGAACTGGCCCTGG - Intergenic
1031528706 7:122851348-122851370 CTGTGCCCAATCACTGGCTCAGG + Intronic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1032081119 7:128858927-128858949 CTGACCCCGAGGACTTGGTCTGG + Exonic
1034273322 7:149813619-149813641 CTGTCCCCCAGCACTGCGTGTGG + Intergenic
1035317206 7:158003603-158003625 CAGTCCCCAAGGCCTGGGTCTGG - Intronic
1035367179 7:158356936-158356958 CTGGGCCCCAGCACAGGGTCAGG + Intronic
1035490891 7:159277378-159277400 CTGTCTGCAAACACTGGGACAGG - Intergenic
1039952460 8:42182738-42182760 CAGTGCCCAGGCACTGGGCCTGG - Exonic
1041467448 8:58171014-58171036 CTTTACCCTCGCACTGGGTCAGG - Intronic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1044972928 8:97637471-97637493 CTGTGCCCAACCACTAGATCAGG - Intergenic
1045081247 8:98628289-98628311 TTGTTCCCAACCACTTGGTCTGG + Intronic
1045500230 8:102738994-102739016 AGGGCCCCAAGCCCTGGGTCTGG + Intergenic
1045989194 8:108285933-108285955 TTGTCCCCAAGCACAGGGCTGGG - Intronic
1048030713 8:130629064-130629086 CTGTCACTGAGCACTGGGTAGGG - Intergenic
1048582617 8:135742765-135742787 CTATCCTCAAACACTGAGTCTGG - Intergenic
1051582385 9:18691392-18691414 CTTTCCCCAAGTACTAGTTCTGG - Intronic
1052623635 9:30945066-30945088 GTGTGAGCAAGCACTGGGTCCGG - Intergenic
1052763669 9:32618529-32618551 CTGTTCCCAGGCACAGGGACAGG + Intergenic
1058703449 9:107619889-107619911 CTGTGGCCAAGCACTGGCTGTGG + Intergenic
1059657611 9:116370210-116370232 CTGTGATCAGGCACTGGGTCAGG + Intronic
1060424478 9:123493150-123493172 CACTCCCCAGGCACTGTGTCAGG + Intronic
1060984177 9:127810138-127810160 CAGTCCTGAAGCCCTGGGTCTGG + Intronic
1061293916 9:129666890-129666912 CTGTCCCCTAGCTCTGGGGATGG + Intronic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1062463862 9:136672743-136672765 CTGGCACCCAGCAGTGGGTCTGG - Intergenic
1186413759 X:9365633-9365655 CTGTCCACAGGCACTTGGGCTGG + Intergenic
1186752198 X:12632659-12632681 CTGTTCCCAAGCAATGGAACAGG + Intronic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1195599344 X:106727515-106727537 CTGTCCCCACGGAGTGGGGCAGG + Intronic
1198517971 X:137427707-137427729 CTGTTGTGAAGCACTGGGTCTGG - Intergenic
1200107444 X:153723087-153723109 CTGTGCCCTAGCCCTGGGACTGG - Intronic
1200157395 X:153984525-153984547 CAGGCCCCAAGCCCTGGGTCGGG - Intergenic
1201422450 Y:13814421-13814443 CTCTTCGCAAGCACAGGGTCAGG - Intergenic
1201584391 Y:15544938-15544960 CTGTCCACATGCACTAAGTCTGG + Intergenic