ID: 1019434427

View in Genome Browser
Species Human (GRCh38)
Location 7:1014867-1014889
Sequence CTGTAGACAGAATTGGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019434427_1019434436 13 Left 1019434427 7:1014867-1014889 CCGAGCACCAATTCTGTCTACAG 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1019434436 7:1014903-1014925 GCGGGCCCTCCCTGCCCTGCAGG No data
1019434427_1019434437 14 Left 1019434427 7:1014867-1014889 CCGAGCACCAATTCTGTCTACAG 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1019434437 7:1014904-1014926 CGGGCCCTCCCTGCCCTGCAGGG 0: 1
1: 0
2: 4
3: 51
4: 451
1019434427_1019434439 18 Left 1019434427 7:1014867-1014889 CCGAGCACCAATTCTGTCTACAG 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1019434439 7:1014908-1014930 CCCTCCCTGCCCTGCAGGGACGG No data
1019434427_1019434430 -5 Left 1019434427 7:1014867-1014889 CCGAGCACCAATTCTGTCTACAG 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1019434430 7:1014885-1014907 TACAGCCCCTTCCTGCCTGCGGG 0: 1
1: 1
2: 0
3: 45
4: 263
1019434427_1019434429 -6 Left 1019434427 7:1014867-1014889 CCGAGCACCAATTCTGTCTACAG 0: 1
1: 0
2: 2
3: 15
4: 130
Right 1019434429 7:1014884-1014906 CTACAGCCCCTTCCTGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019434427 Original CRISPR CTGTAGACAGAATTGGTGCT CGG (reversed) Intronic
908571690 1:65418138-65418160 CTGGAGACAGAATGGGTGGTTGG + Intergenic
908823376 1:68111442-68111464 CTGTAGAGAGAAGGGCTGCTCGG + Intronic
909830359 1:80181583-80181605 TTGCAGAAAGAATGGGTGCTTGG + Intergenic
910855651 1:91692639-91692661 CTGTAGAGAGGAGGGGTGCTTGG - Intronic
911912430 1:103653183-103653205 CGGTAGACAGAAGTCCTGCTTGG + Intergenic
911916024 1:103698765-103698787 CGGTAGACAGAAGTCCTGCTTGG - Intronic
911919844 1:103747321-103747343 CGGTAGACAGAAGTCCTGCTTGG + Intronic
914694409 1:150063149-150063171 CTGCAGATAGAAATGGTTCTAGG + Intergenic
919698340 1:200603939-200603961 CTGTAGACAGAATTTGTGGAAGG - Exonic
920989136 1:210919750-210919772 ATGTAGACAGAATTCTTGCTGGG + Exonic
923979743 1:239308977-239308999 CCAAAGACAGCATTGGTGCTGGG + Intergenic
1065520944 10:26571618-26571640 CTGAAGAAAGAATTGGTGAATGG - Intergenic
1068568800 10:58605974-58605996 GTGTAGAAAGAATTTGTGATAGG - Intronic
1074533908 10:114315183-114315205 CAGTAGCCAGAATTGGGGCTGGG + Intronic
1075026965 10:118992569-118992591 CTGTCACCAGAACTGGTGCTGGG - Intergenic
1080507638 11:32932611-32932633 CTGTAGAATAAATTTGTGCTTGG - Exonic
1085101680 11:73805944-73805966 CTGGAGAAAGAAATGGTTCTAGG - Intronic
1086004088 11:82015572-82015594 CTGAAAACAGGACTGGTGCTGGG + Intergenic
1086464197 11:87037247-87037269 CTGTAGACAGGATTGCTCCGTGG + Intergenic
1087027534 11:93664783-93664805 GTGTAAACAGAATAGGGGCTAGG - Intronic
1090806707 11:130207224-130207246 CTGGAGACAGTATTGGTTTTAGG + Intronic
1091365854 11:135019793-135019815 CTATAGACAGAATCAGGGCTGGG - Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1095505551 12:42893953-42893975 GTGTAGACAGACTTGGGTCTGGG + Intergenic
1096342112 12:50809641-50809663 CTGTAGAAAGAAATGGTGTTAGG + Intronic
1097579268 12:61433629-61433651 CTGTACAATGAATTGTTGCTTGG - Intergenic
1099157673 12:79199543-79199565 TTTTAGAGAGAATTGGTGTTTGG - Intronic
1103371367 12:120421990-120422012 CTGGGGAAAGATTTGGTGCTGGG + Intergenic
1105993345 13:25645763-25645785 TTGTAGTCAGAAAAGGTGCTTGG + Intronic
1109786495 13:67182354-67182376 CTGTAGACAGATTAGATGTTGGG - Intronic
1111890117 13:94070919-94070941 CTAAAAACAGAATTGGTGTTTGG + Intronic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1114660229 14:24339106-24339128 CTGCTGAAAGAAGTGGTGCTTGG - Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121665411 14:95668280-95668302 CTGTAGACAGCATTGGTCAATGG - Intergenic
1122470377 14:101962161-101962183 CTGGAGAGAGAATTCGTTCTAGG - Intergenic
1129025248 15:72566072-72566094 CTGTAGAGGGAAATGGTACTGGG - Intronic
1129899019 15:79131302-79131324 CTATAGAAAGAATAGGGGCTAGG - Intergenic
1130980713 15:88810254-88810276 CTCTAAACAGATTTGGTCCTTGG + Intronic
1131893933 15:97005247-97005269 GTGTAATCAGAATTGGTGTTGGG - Intergenic
1132664846 16:1076661-1076683 CTGAAGAGAGAATTGGTGAATGG - Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1141281690 16:82634910-82634932 CTGCACACACAAGTGGTGCTTGG - Intronic
1145010745 17:19366295-19366317 CTGCATACAGACTTGGCGCTGGG + Intronic
1149228943 17:54509656-54509678 CTGTATACAGTATTGTTTCTGGG - Intergenic
1155100842 18:22608235-22608257 CTGTAGACAGCATCTCTGCTGGG - Intergenic
1156600684 18:38602342-38602364 CTGAAGCCAGAATTGTTACTGGG - Intergenic
1156914832 18:42453612-42453634 GTGAAGACAGAAATGGAGCTGGG + Intergenic
1165576934 19:36827984-36828006 CTGTAGTATGAATTGGTCCTAGG + Intronic
1167259286 19:48449411-48449433 CTGTAGTCAGCATAGGTGCTGGG + Intronic
1168587558 19:57605864-57605886 CTGTGGACAGAAATTGTACTTGG + Exonic
925303048 2:2830508-2830530 CTGCAGCCAGAAATGGTGCTGGG - Intergenic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
925521584 2:4752469-4752491 CTGTCGGCAGATTTGGTTCTTGG + Intergenic
926356277 2:12043612-12043634 CTGAGGACAGGAGTGGTGCTAGG + Intergenic
936790563 2:116146032-116146054 AAGGAGACAGAATTGGAGCTAGG - Intergenic
938891894 2:135713728-135713750 CTGTTGCCAGAGTTGGTGCAGGG + Intronic
939007808 2:136809421-136809443 TTGTAGACAGGATAGGAGCTTGG + Intronic
939385226 2:141487336-141487358 CTTGACACGGAATTGGTGCTTGG + Intronic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
939734151 2:145822834-145822856 CTATAGACTGAATTGATACTAGG - Intergenic
940139704 2:150480487-150480509 CTGGAGAAAGTATTGGTTCTTGG + Intronic
940834622 2:158507242-158507264 CTCTAGAGAGAATTGTTTCTGGG + Intronic
941180232 2:162250923-162250945 CTATAGATGGAATTTGTGCTTGG + Intergenic
941516466 2:166486346-166486368 ATGGAGCCAGACTTGGTGCTAGG - Intronic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
944701714 2:202251751-202251773 GTGTTGACAGATTTGGTTCTTGG + Intergenic
946381264 2:219350623-219350645 CTGGAGGCAGAATTGGTGGCCGG - Intergenic
947717087 2:232346344-232346366 ATGTAGCCAGACTTGGTGGTGGG + Intergenic
1169491826 20:6077579-6077601 CTGTAGACAGAAAATGTGTTGGG - Intronic
1170744846 20:19090266-19090288 CTGTAGACAGAATGCGAACTTGG - Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1173544894 20:43888493-43888515 TTGAACACAGACTTGGTGCTAGG - Intergenic
1175126245 20:56754014-56754036 CTGGAGACAGAATTGGTGTTTGG - Intergenic
1175398008 20:58680778-58680800 ATTTAGATAGAAATGGTGCTAGG - Intronic
1179433096 21:41338569-41338591 CTGTGGGCAGAACTGCTGCTTGG - Intronic
1181914884 22:26272113-26272135 CAGTAGTCAGAATTGGTCCTTGG + Intronic
1182143576 22:27983047-27983069 CTGAAGACAGCAGTGCTGCTGGG + Exonic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182302738 22:29346859-29346881 CAGAAGACAGAATAGATGCTGGG - Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
949860037 3:8496735-8496757 CGGTAGACAGAAATGGTCCATGG - Intergenic
951392108 3:22118732-22118754 CTGTTAACAGAAGAGGTGCTAGG - Intronic
954424652 3:50437009-50437031 CTGCACACAGACATGGTGCTTGG - Intronic
954582223 3:51709065-51709087 CTGGAGGGAGACTTGGTGCTGGG + Exonic
955578229 3:60389411-60389433 CTGTAGACAGAATGTGCCCTTGG - Intronic
956705048 3:71992435-71992457 CTGGAGACCTAATTGGAGCTGGG + Intergenic
957184929 3:76929403-76929425 CTGTGGACAGAACAGGTACTGGG - Intronic
957995898 3:87689806-87689828 GGGTAGACAGAATTGGGGGTTGG - Intergenic
959014693 3:101120710-101120732 CTTTAGAGAGAATTGTTGGTGGG + Intergenic
959731615 3:109610041-109610063 CTGGAGAAAGAATTTGTGGTAGG + Intergenic
960696455 3:120401367-120401389 CTGAAAACAGACTTGGTCCTGGG + Intronic
963863964 3:150340477-150340499 CTGAACACTGAAGTGGTGCTAGG - Intergenic
967548106 3:190756705-190756727 CAGGAGACAGAATTGTAGCTTGG + Intergenic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
968728025 4:2257182-2257204 CTCCAGAAAGATTTGGTGCTCGG - Intronic
968787218 4:2631535-2631557 CTGTAGACAGAGCTGGTATTAGG + Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972414115 4:38821789-38821811 CTGCTGACAGATTTGGTGCCTGG - Intronic
972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG + Intergenic
973191593 4:47391819-47391841 CTATAGACAGAATCTGTTCTAGG + Intronic
974620731 4:64350077-64350099 CTGTTGACAGAAGCAGTGCTGGG + Intronic
978388619 4:108201848-108201870 CAGTAGACTGCATTGGTGGTTGG + Intergenic
979896191 4:126160996-126161018 CTAAAGAGAGAATTGGGGCTGGG + Intergenic
981656700 4:147119872-147119894 CTCTAGGCAGAAGTGATGCTGGG - Intergenic
984833441 4:183997677-183997699 GTGTAGACAGGATTGCTGATGGG + Intronic
985969751 5:3365749-3365771 CTGCAGATAGCCTTGGTGCTTGG + Intergenic
992587340 5:78253562-78253584 CTTTTTCCAGAATTGGTGCTTGG - Intronic
995062050 5:107821821-107821843 CTTTACACAGAATTGTTGTTTGG + Intergenic
995835009 5:116391776-116391798 CTGTACAAAGAATTTGTGCAAGG - Intronic
996289535 5:121835450-121835472 CTGAAGACAGAATTCGGGCCAGG - Intergenic
997658425 5:135572412-135572434 CTGGAGACAGAAGAGGTGGTTGG + Intronic
999353665 5:150903789-150903811 CTGTATACAAAAATGGTGATAGG + Intronic
1007662235 6:43493980-43494002 GTGTAGACAGAATAGGTGTAAGG - Intronic
1008893991 6:56530884-56530906 CTGTATACATAATTTCTGCTGGG + Intronic
1009761932 6:68018283-68018305 CTGAAGACTAAATTGTTGCTGGG + Intergenic
1012522075 6:100134104-100134126 CTGTAGACTTACTTGGTGCTTGG - Intergenic
1014158331 6:118137730-118137752 CTGTAGGCAGAATGGGTTGTAGG - Intronic
1016033800 6:139364374-139364396 CTGTAGCGAGCAATGGTGCTTGG + Intergenic
1016073134 6:139764545-139764567 TTGTAGAAAGAACTGGAGCTTGG - Intergenic
1018360241 6:163060692-163060714 CTGTAGACAGGCCTGCTGCTTGG + Intronic
1018734600 6:166678224-166678246 CTGGAGTAAGAATGGGTGCTGGG - Intronic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1020712459 7:11624842-11624864 CTTTATACAGAATTGGAACTAGG + Intronic
1021202986 7:17746303-17746325 TTGTAGAAAGAATAGGGGCTTGG - Intergenic
1024891001 7:54203557-54203579 CTGTAGAAACAATCAGTGCTGGG - Intergenic
1024975366 7:55109291-55109313 CTATAGAAAGACTTGATGCTTGG - Intronic
1025107107 7:56180673-56180695 ATGTAGGCAGAATGAGTGCTTGG + Intergenic
1026311150 7:69185543-69185565 ATGTAGGCAGAATGAGTGCTTGG - Intergenic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1029499712 7:100921212-100921234 CTGCAGGCAGAATTGCTTCTGGG + Intergenic
1031604565 7:123752727-123752749 TTGTAGCCATAATTGCTGCTTGG + Intergenic
1031976963 7:128100311-128100333 CTGAACACAGAATCTGTGCTGGG - Intergenic
1034237809 7:149586208-149586230 CTGTAGACAAAAATGCTGGTGGG - Intergenic
1035331802 7:158101279-158101301 CTCTAGTCAAAAATGGTGCTGGG + Intronic
1043387371 8:79761656-79761678 CCGGAGACAGAATGGGTGCTGGG + Intergenic
1048965683 8:139612904-139612926 GTGAAGACAGAAATGGTGATGGG + Intronic
1055678764 9:78692966-78692988 CTCGAGACAGAATTGGTGACAGG - Intergenic
1057091700 9:92263861-92263883 CTAAAAACAGAATTTGTGCTGGG + Intronic
1058837719 9:108873939-108873961 CTCTAGACAGAAGAGGAGCTAGG + Intronic
1059504655 9:114787387-114787409 CTGCAGACAGTAGAGGTGCTGGG + Exonic
1059550084 9:115220397-115220419 CTGGAGCCAGAATTAGTGATGGG - Intronic
1186006390 X:5076990-5077012 TTGTAGAAAGAATGGGGGCTTGG - Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG + Intronic
1196904794 X:120420601-120420623 CTATGGATAGTATTGGTGCTAGG + Intergenic
1197199537 X:123735850-123735872 CTGTATTCAGAACTGGTTCTGGG + Intergenic
1197963364 X:132029802-132029824 CAATAGACAGAATAGGTGCTTGG - Intergenic