ID: 1019434955

View in Genome Browser
Species Human (GRCh38)
Location 7:1017799-1017821
Sequence CCTTGTGTGCAGTGGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 540}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019434955_1019434965 -9 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434965 7:1017813-1017835 CACACAAGGCCAGGCGCTCTGGG No data
1019434955_1019434966 -8 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434966 7:1017814-1017836 ACACAAGGCCAGGCGCTCTGGGG 0: 1
1: 0
2: 2
3: 16
4: 162
1019434955_1019434964 -10 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434964 7:1017812-1017834 GCACACAAGGCCAGGCGCTCTGG No data
1019434955_1019434969 6 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434969 7:1017828-1017850 GCTCTGGGGCCCAGCATCCAGGG No data
1019434955_1019434968 5 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434968 7:1017827-1017849 CGCTCTGGGGCCCAGCATCCAGG No data
1019434955_1019434973 28 Left 1019434955 7:1017799-1017821 CCCGCCCCCCACTGCACACAAGG 0: 1
1: 0
2: 1
3: 47
4: 540
Right 1019434973 7:1017850-1017872 GCTCAAAACCACACCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019434955 Original CRISPR CCTTGTGTGCAGTGGGGGGC GGG (reversed) Intronic
900008527 1:83310-83332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900036758 1:417393-417415 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900058387 1:653140-653162 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900438276 1:2641526-2641548 ACATGCGTGCAGTGGGGGCCCGG + Exonic
900596099 1:3480867-3480889 CCCTGGGTGCAGTGGGGAGGTGG - Exonic
900698931 1:4032004-4032026 CCTTGGGTGGGGTGGGGGGGGGG + Intergenic
900972124 1:5997463-5997485 GCAGGTGTGCAGTGGGGGTCTGG - Intronic
901034152 1:6326223-6326245 CCATGTGTGCAGTAGGGAGAGGG + Intronic
901882708 1:12203484-12203506 TCCTGTGGGCAGTTGGGGGCAGG - Intronic
902146471 1:14405040-14405062 CTTTGTGTGTGGTGGGGGGTAGG + Intergenic
902581432 1:17410182-17410204 CCTTGTGTGCAAGGGTGGCCGGG - Intronic
904465707 1:30706112-30706134 CTTTCTGTGCAGTGAGCGGCAGG + Intergenic
904816610 1:33207098-33207120 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
905651059 1:39657321-39657343 GGTTCTGTGCAGTGTGGGGCAGG - Intergenic
905822201 1:41002148-41002170 TCTTTTGTGCAGTGGAGTGCTGG + Exonic
906210569 1:44010447-44010469 CCTTGTGGGCGGGGGGGGGGGGG + Intronic
906258250 1:44367150-44367172 CCTTCTGTCCAGTGAGGGGCAGG - Intergenic
906363652 1:45186244-45186266 ACTGTTGTGCAGTGGGGGGAGGG + Intronic
907005083 1:50905034-50905056 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
907247538 1:53117678-53117700 GATTGTGTGGAGTGGGGTGCAGG + Intronic
907311693 1:53542501-53542523 CCTTGAGGGAAGTGTGGGGCGGG + Intronic
907716542 1:56931721-56931743 GCTGGTGTGGAGTGTGGGGCTGG - Intronic
907858048 1:58323083-58323105 CCTATTGTGGGGTGGGGGGCAGG + Intronic
908042462 1:60129300-60129322 AGTTGTGTGCAGTGGTGAGCAGG + Intergenic
909558901 1:76987011-76987033 CCTGTTGTGGAGTGGGGGACTGG + Intronic
911377580 1:97069744-97069766 CTTTGGGGGCAGTGGGGGGGGGG + Intergenic
911402316 1:97391510-97391532 CCTTGTATGGAGTGAGGTGCAGG + Intronic
911605758 1:99903283-99903305 CCTGTTGTGGAGTGGGGGGATGG - Intronic
912963228 1:114214405-114214427 CTTGGTGTCCAGTGGGGTGCTGG + Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
914391564 1:147228157-147228179 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
914747376 1:150510157-150510179 CCTTCTGTTCATTGGGGTGCTGG - Exonic
914905838 1:151742932-151742954 CCTTGTGGACAGTGGTGCGCTGG + Intergenic
915091493 1:153429374-153429396 TCTTTTGGGCAGTGAGGGGCTGG - Intergenic
915463166 1:156081674-156081696 CTTTGGGGGCGGTGGGGGGCTGG + Exonic
915767906 1:158385517-158385539 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
915807751 1:158872432-158872454 CCTGTTGTGCAGTGGGGGGGAGG + Intergenic
917010918 1:170469863-170469885 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
917760975 1:178157452-178157474 CCTTGTGTGGAGTGGGGAATTGG + Intronic
918467320 1:184834006-184834028 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
918636662 1:186782875-186782897 CCTTCTCTGCAGTGAGAGGCAGG + Intergenic
919046996 1:192464936-192464958 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
919230510 1:194766816-194766838 ACGTGTGTGCATTGGGGGGGGGG + Intergenic
919825541 1:201500648-201500670 TCTTGTGGGCAGAGGGGGACAGG - Intronic
919952908 1:202382266-202382288 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
920043813 1:203120827-203120849 CCTTGTGTCAGGTGGGGGGGTGG + Intronic
920088596 1:203435888-203435910 CCCTGTCTGGAGTTGGGGGCGGG - Intergenic
920995082 1:210982417-210982439 ACTGGTGTGGAGTGGGGGGAAGG - Intronic
923086290 1:230705818-230705840 CCTTGGGTGCAGAGCAGGGCAGG - Intronic
923991712 1:239445001-239445023 CCTTGTGTGCAGTGGGCCACTGG + Intronic
1063299926 10:4842172-4842194 TCTAATGTCCAGTGGGGGGCTGG + Intronic
1063629909 10:7723578-7723600 CCTTGTTTGCAGTGGTTGGGGGG + Intronic
1064910257 10:20393521-20393543 CCTTGTGTGCCTTGGGTGGCTGG + Intergenic
1065687672 10:28302667-28302689 CCTTGTGAGGAGGTGGGGGCGGG - Intronic
1065697780 10:28395676-28395698 CCTTGTGTATTGTGGGGGGTAGG + Intergenic
1066172686 10:32868716-32868738 CCTTTTGTGGGGTGGGGGGAGGG - Intronic
1067059781 10:43072345-43072367 ACCTGTGTGCTGTGTGGGGCTGG - Intergenic
1067340846 10:45402248-45402270 CCTTGACAGCAGTGGGTGGCTGG - Intronic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1068210582 10:53914607-53914629 CCTGTTGTGGAGTTGGGGGCTGG + Intronic
1068290496 10:54996032-54996054 CTTTCTGTGCAGTGGGGAGCAGG + Intronic
1069193865 10:65524475-65524497 CCTGTTGTGGAGTGGGGGGACGG + Intergenic
1069194211 10:65528205-65528227 CCTGTTGTGGAGTGGGGGGACGG + Intergenic
1069969213 10:72151438-72151460 CCTGTTGTGGTGTGGGGGGCCGG + Intronic
1070765847 10:79055866-79055888 CCTTCTGGGAAGTAGGGGGCTGG + Intergenic
1070870395 10:79746287-79746309 GTTTTTTTGCAGTGGGGGGCTGG + Intergenic
1071600959 10:86958514-86958536 CCCTGCGTGCAGTGGGGGCGGGG - Intronic
1071637314 10:87268507-87268529 GTTTTTTTGCAGTGGGGGGCTGG + Intergenic
1071657932 10:87469447-87469469 GTTTTTTTGCAGTGGGGGGCTGG - Intergenic
1071748535 10:88448992-88449014 CCTGTTGTGCAGTGCGGGGAGGG + Intronic
1072394469 10:95024676-95024698 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1072634456 10:97169075-97169097 TCTTGTGTGGAGTGGGGTGTAGG - Intronic
1074095105 10:110304747-110304769 CCTTGTGTGGGGCTGGGGGCGGG + Exonic
1074432633 10:113406888-113406910 GCTTCTGTGCAGTGTGGGGCTGG + Intergenic
1074433361 10:113412638-113412660 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
1074851617 10:117443766-117443788 CCATGTGTCCAGTAGGGGCCTGG + Intergenic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076333320 10:129687845-129687867 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1076756512 10:132575371-132575393 CCCTGTGAGCTGCGGGGGGCTGG - Intronic
1077474153 11:2778538-2778560 CCTGGTGGGGAGTGGGGGCCTGG - Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078854214 11:15193441-15193463 CCTGTTGTGGAGTGGGGGGATGG - Intronic
1079284183 11:19114681-19114703 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1079320080 11:19444551-19444573 GCAGGTGGGCAGTGGGGGGCCGG - Intronic
1080346302 11:31329547-31329569 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
1080828068 11:35864875-35864897 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1081314245 11:41612111-41612133 CCTTGTGGGGTGTGGGGAGCGGG + Intergenic
1082613315 11:55329438-55329460 CCTGTTGTGGAGTGGGGGGTAGG - Intergenic
1082983457 11:59145078-59145100 CCTTGTGTGCTGGGGGGAGCGGG + Exonic
1083727819 11:64637533-64637555 TCTTGTGTGGAGTGGGGAGGAGG - Intronic
1083872598 11:65498321-65498343 CCGTGCGGGCCGTGGGGGGCTGG + Intergenic
1084856049 11:71987228-71987250 ACTTGGGTGCTGTGGGGGGATGG + Intronic
1085614608 11:77986830-77986852 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1086189664 11:84063956-84063978 CCTGTTGTGGGGTGGGGGGCTGG + Intronic
1086229219 11:84548429-84548451 CCTGTTGTGGGGTGGGGGGCGGG - Intronic
1086498439 11:87427451-87427473 CCTGTCGTGCAGTGGGGGGAGGG - Intergenic
1086964261 11:93011380-93011402 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
1087752993 11:102025849-102025871 CTATGTGTGCAGTAGGGGGGAGG + Intergenic
1088364896 11:109030461-109030483 CCTTTTGTGGAGTGGGGGGGAGG - Intergenic
1088365789 11:109038592-109038614 AGTTGTGAGCAGTGGGAGGCAGG + Intergenic
1088370611 11:109084539-109084561 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1088394321 11:109349722-109349744 CCTTTTGTGGGGTGGGGGGGGGG + Intergenic
1088745131 11:112798625-112798647 CCTTGCATGAAGTGGGGGGCAGG + Intergenic
1089184915 11:116608336-116608358 GCATGTGTGTAGTGGAGGGCAGG - Intergenic
1089491457 11:118886734-118886756 GCTGGTGTGCAGGGTGGGGCTGG - Intronic
1090076933 11:123585467-123585489 CCTTGTTTGCGGTGCTGGGCAGG - Intronic
1090120165 11:124018349-124018371 CCTTTTGGGGGGTGGGGGGCTGG - Intergenic
1091002994 11:131926394-131926416 CCTGGTGTGCAGGGAGGGGTAGG + Intronic
1091195167 11:133724635-133724657 CCTGTTGTGGGGTGGGGGGCGGG - Intergenic
1091278042 11:134365390-134365412 CCATGTGTGCAGTGGAGTGGGGG + Intronic
1091289967 11:134433954-134433976 CCTTGTCTGCATCTGGGGGCAGG + Intergenic
1091406698 12:213797-213819 GCGTGTCTGCAGCGGGGGGCAGG - Intronic
1091804800 12:3348191-3348213 CCCTGGGTGGAGTGGGGGGGTGG + Intergenic
1092886696 12:12930532-12930554 CCCTGTGTGCAGCAGAGGGCTGG - Intergenic
1092904498 12:13089534-13089556 GCTAGTGTGCACTGAGGGGCAGG + Intronic
1093597138 12:20975739-20975761 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1094334168 12:29328735-29328757 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
1095576947 12:43751345-43751367 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1095601121 12:44014127-44014149 GCTTTTGTGCTGTGGGGGACAGG - Intronic
1095764414 12:45878753-45878775 CCGTGTGTGTGGTGGTGGGCGGG + Intronic
1096697054 12:53356090-53356112 CCTTGAGTGCAGTGGTAGGACGG - Intergenic
1096950644 12:55465295-55465317 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1099406734 12:82273010-82273032 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1101735453 12:107459810-107459832 CCCTGTGTGCTGTGGGTGGCAGG + Intronic
1102965681 12:117123728-117123750 CCTTGTGTCGAGTGCAGGGCTGG + Intergenic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1103910215 12:124348115-124348137 CCTGGTGGGCGGTGGGGGGATGG - Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104564305 12:129866436-129866458 CCTGTTGTGCGGTGGGGGGAGGG + Intronic
1104919117 12:132281385-132281407 CCACGTGTGCAGGGGTGGGCTGG + Intronic
1104971091 12:132530980-132531002 CCTTGTGTCCAGTGTGGGGGGGG + Intronic
1106558273 13:30828528-30828550 ACTGGGGTGGAGTGGGGGGCAGG - Intergenic
1106959609 13:34983169-34983191 CCTGGTGTGGGGTGGGGGTCAGG - Intronic
1107214673 13:37902502-37902524 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1107224949 13:38038028-38038050 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
1107977903 13:45707224-45707246 GCTTGTGTGCAGGGGGTGGTGGG + Intronic
1108445322 13:50503186-50503208 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1108642525 13:52395923-52395945 ACTTGGGTGCAGTGGGTGGCTGG + Intronic
1109084638 13:57954392-57954414 CCTGTTGTGCGGTGGGGGGAAGG - Intergenic
1109981734 13:69916583-69916605 CCTGTTGTGGAGTGGGGGGAAGG + Intronic
1112663253 13:101539200-101539222 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
1113109940 13:106812232-106812254 CCTTCTGTACAGGGTGGGGCTGG + Intergenic
1113521864 13:110947163-110947185 GCTTGTGGACAGTGAGGGGCTGG + Intergenic
1113706029 13:112433536-112433558 GCTTGTGGACAGTGAGGGGCTGG - Intronic
1113738821 13:112697029-112697051 GCTTGCGCGCAGTGGGTGGCGGG + Intronic
1114483615 14:23049760-23049782 CCTTGTATGGAGTGGGCTGCTGG + Intronic
1115958685 14:38810346-38810368 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1116538027 14:46060574-46060596 CCTGTTGTGGGGTGGGGGGCAGG + Intergenic
1117101241 14:52350461-52350483 CCTTATGTGTGGTGGGGGACGGG + Intergenic
1117246094 14:53888082-53888104 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1117446546 14:55808698-55808720 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1117902743 14:60551693-60551715 GCTGGTGTGCAGTGGGGGAGTGG - Intergenic
1118256567 14:64210561-64210583 CCCTGTCTGCACTGGGGGGTTGG + Intronic
1120090698 14:80329731-80329753 CCTAGTGTGGGGTGGGGGGCTGG + Intronic
1121432950 14:93900276-93900298 GCTTGTCTGCAGCTGGGGGCAGG - Intergenic
1121626182 14:95387066-95387088 GTGTGTGTGCAGTGGGGAGCAGG - Intergenic
1122684247 14:103492350-103492372 TCTGGTGTGGGGTGGGGGGCTGG + Intronic
1122711778 14:103663747-103663769 CCTAGGATGCAGTTGGGGGCTGG + Intronic
1122773728 14:104108152-104108174 CCTTTTGTGAAGTGGGTGACTGG + Intronic
1122919858 14:104875539-104875561 CGCTGTGTGGAGTTGGGGGCCGG + Intronic
1124007283 15:25804631-25804653 ACCTGTGTGGAGTGGGTGGCCGG - Intronic
1125524441 15:40366165-40366187 CCTCGTGTGAAGTGGGGGGCTGG - Intronic
1126016276 15:44354292-44354314 CCTGTTGTGTAGTGGGGGGAGGG + Intronic
1126086445 15:45014858-45014880 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
1126131601 15:45347352-45347374 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1126817990 15:52472542-52472564 CCTGTTGTGCGGTGGGGGGATGG - Intronic
1126839704 15:52705348-52705370 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1126889506 15:53189055-53189077 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
1127134602 15:55906625-55906647 CCTGTTGTGGGGTGGGGGGCTGG + Intronic
1127433443 15:58933832-58933854 CCTTGTGTGGACTGGGAGGTCGG + Intronic
1128792313 15:70442305-70442327 CCATGTGTGCAGTGGGCTGTAGG + Intergenic
1128927175 15:71668375-71668397 CCAGGTGTGCAGAGGGGGTCTGG + Intronic
1129366191 15:75056597-75056619 CCTTGTGGCCAGTGGAGGGAGGG + Intronic
1129377482 15:75143234-75143256 CCTTATGGGCAGTTGGGGCCTGG + Intergenic
1129636174 15:77320807-77320829 CCTGTTGTGCTGTGGGGGACGGG - Intronic
1129749078 15:78047796-78047818 CAGTGTCTGGAGTGGGGGGCAGG + Intronic
1129897232 15:79117542-79117564 CCTTTTGGGCAGTGGAGTGCAGG - Intergenic
1130313106 15:82771782-82771804 CCCTGTGTGCAGGAGGGGCCAGG - Intronic
1131250499 15:90827181-90827203 CTTCGTGTGCAGTGGGAGCCTGG + Intergenic
1131345324 15:91642359-91642381 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
1131432863 15:92400717-92400739 CACTGTGGGCAGTGGAGGGCTGG - Intronic
1131814295 15:96206415-96206437 CCTGTTGTGGAGTGGGGGGGAGG + Intergenic
1132062043 15:98700370-98700392 CCTTATCTGCAGTGTGGTGCAGG - Intronic
1132445027 15:101908808-101908830 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1132574908 16:659796-659818 CCCCGTGAGCAGTGGAGGGCAGG + Intronic
1132871853 16:2118898-2118920 CCTGGTTGCCAGTGGGGGGCTGG - Intronic
1133129085 16:3665058-3665080 CCATGTGTGCAGGGGTGGCCTGG - Exonic
1133149661 16:3818167-3818189 CCATGTGACCAATGGGGGGCCGG + Intronic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133540176 16:6743715-6743737 CCCTGAGTGCAGTGGAGTGCAGG - Intronic
1133884543 16:9813788-9813810 CTTTGTTTGCAGTGTGGGGGTGG + Intronic
1134520674 16:14917998-14918020 CCTGGTTGCCAGTGGGGGGCTGG + Intronic
1134550901 16:15137976-15137998 CCTGGTTGCCAGTGGGGGGCTGG - Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1134708346 16:16316649-16316671 CCTGGTTGCCAGTGGGGGGCTGG + Intergenic
1134715561 16:16356682-16356704 CCTGGTTGCCAGTGGGGGGCTGG + Intergenic
1134951256 16:18351996-18352018 CCTGGTTGCCAGTGGGGGGCTGG - Intergenic
1134959196 16:18395477-18395499 CCTGGTTGCCAGTGGGGGGCTGG - Intergenic
1135520413 16:23172688-23172710 CCTTGTGAGCTGGAGGGGGCTGG - Intergenic
1135691363 16:24540044-24540066 GTTTGTGTGCGGTGGGGGCCTGG + Intronic
1136100770 16:27994019-27994041 TCTCCTGTGCAGTGGGGGCCTGG - Intronic
1136282310 16:29221028-29221050 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139464258 16:67145758-67145780 CCTAATGTGCAGAGTGGGGCAGG - Intronic
1139486070 16:67257233-67257255 CCTTGAGTGCAGTGGGGTAGGGG + Intronic
1139711972 16:68782778-68782800 CCCTGTGTGGGGTGAGGGGCAGG - Intronic
1139847148 16:69929238-69929260 CCTTGTTGGTGGTGGGGGGCGGG - Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1141114807 16:81299435-81299457 CTTTGTATGCAGTGTGAGGCAGG + Intergenic
1141988347 16:87594434-87594456 CCTTGGGTGGGGTGGGGGGCCGG + Intergenic
1142060455 16:88026012-88026034 CCGGGCGTGCAGTGGGGCGCTGG + Intronic
1142086682 16:88186946-88186968 CCGTCTCTGCAGTGGGGGGCAGG - Intergenic
1142965327 17:3577387-3577409 CCTGGTGTGCAGGGGGGGTCAGG + Intronic
1143598166 17:7928148-7928170 GGTTGTGTGCAGTGAGGGGCTGG + Intronic
1143682569 17:8488238-8488260 CCTAGTGTGCAGTGGGGATAGGG + Intronic
1144391494 17:14797909-14797931 CCTTGTTTGCTGTGGTGTGCTGG - Intergenic
1148701170 17:49587857-49587879 CCTGGGGCGCAGTGAGGGGCAGG + Intergenic
1148742278 17:49899487-49899509 CCTGGACTGCAGTGGAGGGCGGG + Intergenic
1149656272 17:58311010-58311032 GCTTGGGTGCGGTGAGGGGCAGG + Exonic
1150188449 17:63212027-63212049 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1151504972 17:74521716-74521738 GCTTGTGGGCAGGTGGGGGCGGG + Exonic
1152813580 17:82393898-82393920 CCTCGTGAGCTGTGGGAGGCAGG + Intronic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1155102167 18:22622192-22622214 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1156559804 18:38110963-38110985 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1156930571 18:42637618-42637640 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1157562018 18:48654966-48654988 GCCTGTGTGGGGTGGGGGGCAGG + Intronic
1157680737 18:49603387-49603409 CCTGTTGTGCAGTGGGGACCTGG + Intergenic
1157772308 18:50359748-50359770 CATTGTGTGGAGTGGGGCTCGGG + Intergenic
1158052397 18:53239037-53239059 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
1158113927 18:53973915-53973937 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
1158926628 18:62270792-62270814 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
1159287585 18:66373974-66373996 CCTTGAATGAAGTGGGGGCCAGG + Intergenic
1160351968 18:78190270-78190292 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1160506202 18:79427949-79427971 GCCTCTGTGCAGTGGGTGGCGGG + Intronic
1160640285 19:124903-124925 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1160774024 19:846590-846612 CCTAGAGGGGAGTGGGGGGCAGG - Intronic
1160929881 19:1565685-1565707 CCTGGGGTACAGTGGGGGTCGGG - Intronic
1161044519 19:2128121-2128143 CCTTCCCTGCAGTGGGGGCCGGG + Intronic
1161328109 19:3673026-3673048 CCTTGTCTGCGGTGGGGGCGGGG - Intronic
1161395626 19:4043609-4043631 CCTGGGGTGGGGTGGGGGGCGGG + Intergenic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1162590442 19:11587887-11587909 CCTAGTGGCAAGTGGGGGGCTGG - Intronic
1163639200 19:18451814-18451836 CTTTGGGTGAAGTCGGGGGCAGG - Intronic
1164150661 19:22547741-22547763 CCTCTAGTGGAGTGGGGGGCAGG - Intergenic
1164583124 19:29447388-29447410 CCTTGTGCACAGTGAGGGACTGG - Intergenic
1164650412 19:29887158-29887180 CATTTTGTGCGGCGGGGGGCGGG - Intergenic
1165225644 19:34352862-34352884 CCTTGTGTGCTGGTGGGGGTGGG - Exonic
1165615571 19:37197128-37197150 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1165892454 19:39122115-39122137 CCTTGTCAGCACTGGGGGCCAGG - Intergenic
1166347290 19:42174732-42174754 GTCAGTGTGCAGTGGGGGGCTGG - Intronic
1166347298 19:42174765-42174787 GTCAGTGTGCAGTGGGGGGCTGG - Intronic
1167169047 19:47818891-47818913 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
1167688081 19:50968938-50968960 CCCTGAGTGCAGTGAGGGCCTGG + Exonic
1167743444 19:51337960-51337982 CGTGCTGTGCAGTGGGGCGCTGG - Exonic
925477899 2:4239094-4239116 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927397816 2:22674307-22674329 ACTAGTGTGAAGTGGGAGGCAGG + Intergenic
928125153 2:28610566-28610588 CCATGTGTGCAATGAGTGGCTGG - Intronic
928479182 2:31664298-31664320 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
928689264 2:33782290-33782312 TCTTATGTGCATTGGGGTGCTGG - Intergenic
928820828 2:35358652-35358674 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
929254726 2:39797730-39797752 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
930239141 2:48917909-48917931 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930577332 2:53166761-53166783 CCTGTTGTGGGGTGGGGGGCGGG + Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
931641348 2:64383304-64383326 CCTTCTATGCAGTGCGGTGCTGG + Intergenic
932061924 2:68510061-68510083 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
932195933 2:69783763-69783785 TCTTGTGTGGAGTGGAGGGTGGG - Intronic
932309290 2:70726940-70726962 CCCTGTGTGCATTGTGGGGTTGG - Intronic
932330360 2:70895216-70895238 CCTTGTGTGCTCTGGGCTGCAGG - Intergenic
932874601 2:75437335-75437357 CCTTTTGTGGGGTGGGGGGATGG - Intergenic
933231313 2:79810675-79810697 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
934519969 2:95013939-95013961 TCTGGTGTGCAGGGGCGGGCAGG + Intergenic
934998263 2:98987247-98987269 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
935237127 2:101148974-101148996 CCACGTGTGCTGTGGGGGGCTGG - Intronic
935397713 2:102625468-102625490 CCTGTTGTGCGGTGGGGGGAGGG - Intronic
936225070 2:110641538-110641560 GCTTTTGTGGAGTGGTGGGCAGG - Intronic
936807610 2:116355589-116355611 CCTTGTGTGTGGTGGGGGGGCGG + Intergenic
939705507 2:145447739-145447761 CCCTGTCAGCAGTGGGGGGTAGG - Intergenic
940080030 2:149790774-149790796 CCTGTTGTGCAGTGAGGGGAAGG - Intergenic
940211219 2:151258282-151258304 TCTTGTGTGCACTGGGGGTAGGG - Intronic
940667634 2:156628094-156628116 ACTTCTGTGCAGTGGGGTGCTGG + Intergenic
941007582 2:160263369-160263391 CCTCATGGGCAGTGGGGAGCTGG - Intronic
941042834 2:160642610-160642632 CCTGTCGTGGAGTGGGGGGCAGG - Intergenic
941773984 2:169371921-169371943 CCTGGTGGGTGGTGGGGGGCAGG + Intergenic
942111554 2:172687862-172687884 CTTTGTGTTCAGTGGGCAGCAGG - Intergenic
942875173 2:180786492-180786514 CCTTTTGTGGGGTGGGGGGCAGG + Intergenic
945895949 2:215481830-215481852 CCTTGTAGGGAGTGAGGGGCAGG + Intergenic
946180011 2:217943302-217943324 CCTTGGCTGCAGGGAGGGGCTGG - Intronic
947074595 2:226328603-226328625 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
947214084 2:227734505-227734527 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
947258985 2:228199284-228199306 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
948063272 2:235057637-235057659 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
948070540 2:235118817-235118839 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
948396338 2:237647833-237647855 CCCTGCGTGCAGTGAGTGGCCGG - Intronic
948606423 2:239138731-239138753 CATTGTGTGGAGTGTGGGGCAGG + Intronic
1168840782 20:908769-908791 GTTTGTGTGTGGTGGGGGGCAGG + Intronic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1170963529 20:21046620-21046642 CCATGTGGCCAGTGAGGGGCAGG + Intergenic
1171233951 20:23509539-23509561 CCCTGTCTGAAGTGGGAGGCAGG - Intergenic
1172597867 20:36162711-36162733 GCTGATGTGCAGTGGTGGGCTGG - Intronic
1174390505 20:50216000-50216022 CTGTGTTTGCAGTGTGGGGCTGG + Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1174595195 20:51678386-51678408 CCTTCAGTGCATTTGGGGGCGGG - Intronic
1174759411 20:53192477-53192499 CCTTGTGGGCATTTGGGAGCTGG + Intronic
1175620844 20:60446068-60446090 CCTTGTCTGCAGTGGAGGAAAGG - Intergenic
1175676094 20:60948059-60948081 CCTTGTGTCCCGTGGAGGGCGGG + Intergenic
1175793347 20:61756463-61756485 CCATGTGAGTAGTGGGGGACAGG - Intronic
1177184673 21:17780365-17780387 CCATGGGGGCAGTGGGGAGCAGG - Intergenic
1179775533 21:43659556-43659578 CCTTCTGTGCAGTCGCGGCCCGG + Exonic
1179930552 21:44568455-44568477 CCTTGGGTGCTGTGGGAGGCTGG + Intronic
1180109024 21:45639191-45639213 CTCTGTGTGCAGTGGGGGAGGGG + Intergenic
1180710051 22:17833305-17833327 CCTTGCCTGCAGTGAGAGGCCGG + Intronic
1180868341 22:19132491-19132513 CGTTGTGTGTGGTGGGGGTCGGG + Exonic
1181266791 22:21635295-21635317 CCTGGAGTGGAGTGAGGGGCTGG - Intronic
1181777611 22:25170843-25170865 CCTTGGGTTCAGTGGGCTGCCGG - Exonic
1181851123 22:25750705-25750727 CCTTGTGGCCAGTGGAGGGGAGG + Intronic
1182094592 22:27617463-27617485 CCTTGTGCCCAGTGCTGGGCTGG + Intergenic
1183603081 22:38851249-38851271 CCTCGTGTGTGGTGGGAGGCTGG - Intergenic
1183705229 22:39471647-39471669 CCCTGTGTGGTGTGGGGGACAGG - Intronic
1184689934 22:46112901-46112923 CCTTGGCAGCAGTCGGGGGCAGG + Intronic
1184805908 22:46794734-46794756 CCCTGAGAGCAGTGGGGAGCAGG + Intronic
1184985141 22:48127196-48127218 CCTTTTGGGGGGTGGGGGGCAGG - Intergenic
1185248765 22:49788436-49788458 ACTTCTGTGCTGTGGGGAGCGGG - Intronic
1185339206 22:50284102-50284124 CCACGGGCGCAGTGGGGGGCGGG - Intronic
1185361972 22:50413794-50413816 CATTGTTTCCAGTGGAGGGCTGG + Intronic
1185377094 22:50487615-50487637 CCTCGTGTGCAGGGTGGGGGTGG + Intronic
949120867 3:382031-382053 CCATATGTGGGGTGGGGGGCGGG + Intronic
949268949 3:2191877-2191899 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
949564505 3:5232364-5232386 CCTGGTGGGCAGTGTGGGGATGG + Intergenic
950331225 3:12157760-12157782 CCGTTTGTGCAGTGGGGCACAGG + Intronic
950612909 3:14137518-14137540 CCTTGTGTGGGGGTGGGGGCTGG - Intronic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
951421545 3:22491899-22491921 CCAAGTGTGCAGTGATGGGCAGG + Intergenic
951471430 3:23060823-23060845 CCTGTTGTGCGGTGGGGGGATGG + Intergenic
953080741 3:39615146-39615168 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
953545886 3:43863357-43863379 ACTTGTGTGTGGTGGGGGTCGGG + Intergenic
953553205 3:43921141-43921163 ACATTTGTGCGGTGGGGGGCTGG + Intergenic
954443766 3:50535761-50535783 CCTTGGGAGCAGGGGTGGGCTGG - Intergenic
955212044 3:56951122-56951144 CCTGTTGTGCGGTGGGGGGAGGG + Intronic
955552342 3:60097862-60097884 CCTGTTGTGGGGTGGGGGGCGGG - Intronic
955891117 3:63651166-63651188 CCTGTTGTGGGGTGGGGGGCGGG + Intergenic
956113729 3:65897461-65897483 CCTGCTGTGGGGTGGGGGGCAGG + Intronic
956395027 3:68816158-68816180 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
956467062 3:69529595-69529617 CTCTGAGTGCAGTGGAGGGCAGG - Intronic
958705971 3:97655749-97655771 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
959039670 3:101406426-101406448 CCTGTTGTGGAGTGGGGGGAGGG + Intronic
959041553 3:101427844-101427866 CCTGTTGGGGAGTGGGGGGCTGG - Intronic
960251805 3:115463773-115463795 CCTGTTGTGGGGTGGGGGGCGGG + Intergenic
960755079 3:121002703-121002725 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
961779935 3:129315473-129315495 CTTTGTGCGCGGTGGGGGCCGGG + Exonic
961906129 3:130264511-130264533 CCTTGGGTGGAGTGGGGAGAGGG + Intergenic
961959524 3:130840037-130840059 CCTGCTGTTAAGTGGGGGGCGGG + Intergenic
961988654 3:131164172-131164194 CATTGTGAGCAGTGGTGTGCTGG + Intronic
962236514 3:133711841-133711863 CGGTGAGTGCAGTGGGGGGCAGG - Intergenic
962642119 3:137398510-137398532 CCTGTTGTGTGGTGGGGGGCTGG + Intergenic
962645667 3:137436519-137436541 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
962818811 3:139026771-139026793 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
963069925 3:141295688-141295710 CCTGTTGTGGAGTGGGGGGCTGG - Intergenic
963085711 3:141434382-141434404 CTGTGTGTGCACTGGGGGGGCGG + Intronic
964136123 3:153346664-153346686 CCTATTGTGGGGTGGGGGGCTGG - Intergenic
965249198 3:166320103-166320125 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
965485297 3:169271601-169271623 CCTGTGGTGCAGTTGGGGGCTGG + Intronic
965526077 3:169719770-169719792 CCTGTTGTGAGGTGGGGGGCTGG - Intergenic
965795953 3:172438846-172438868 GGGTGTGTGGAGTGGGGGGCTGG - Intergenic
966766090 3:183463878-183463900 GCATGTGTGGGGTGGGGGGCTGG + Intergenic
967125160 3:186416687-186416709 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
967484280 3:190012232-190012254 GTGTGTGTGTAGTGGGGGGCGGG + Intronic
967757449 3:193185718-193185740 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
967853596 3:194100168-194100190 CCTTGTGGGCGGTGGGTGGTGGG - Intergenic
968337744 3:197927950-197927972 CCTGTTGTGGGGTGGGGGGCTGG + Intronic
968949126 4:3681352-3681374 CGTTGTGTGCAGGCGGAGGCAGG + Intergenic
968962219 4:3751454-3751476 CCTAGTGGGCAGGGCGGGGCAGG - Intergenic
969258590 4:6019849-6019871 CCTAGTGTTCAGTGGGAGGAAGG + Intergenic
969291553 4:6243244-6243266 GCTGTTGGGCAGTGGGGGGCTGG + Intergenic
969903701 4:10373410-10373432 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
970342819 4:15124549-15124571 TCTTGTGTGCAGTGTGAGGTAGG + Intergenic
971750895 4:30646486-30646508 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
972916805 4:43891677-43891699 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
973103978 4:46308369-46308391 CCTTTTGTGGAGTGGGGGTAGGG + Intronic
974521996 4:62994213-62994235 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
974568412 4:63609918-63609940 TGTTGTGTGCGGTGGGGGGAGGG - Intergenic
975157122 4:71084552-71084574 CCTGTTGTGCAGTGGGGGCAGGG - Intergenic
975173758 4:71263011-71263033 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
975527507 4:75366811-75366833 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
975543049 4:75533908-75533930 CCTGTTGTGCGGTGGGGGGAGGG - Intronic
976964640 4:91022149-91022171 CCTGGTGTGGGGTGGGGGGAGGG - Intronic
977711721 4:100134286-100134308 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
978204760 4:106068299-106068321 CCTGGTGTGGGGTGGGGGGATGG - Intronic
978272110 4:106903335-106903357 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
978886625 4:113772721-113772743 CTGGGTGTGCAGTGGGGGACTGG + Intergenic
978997799 4:115177711-115177733 ACTGTTGTGCAGTGGGGGGAGGG + Intergenic
980591871 4:134901218-134901240 CCTGTCGTGCAGTGGGGGGAGGG - Intergenic
981010819 4:139922990-139923012 CCTTCTGAGCACTGGGGTGCAGG - Intronic
983434847 4:167699710-167699732 CCATGTGATCAGTGGGGAGCAGG - Intergenic
983756058 4:171337716-171337738 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
984113041 4:175643925-175643947 CCGCATGTGCAGTGGGTGGCCGG - Intronic
985388330 4:189468170-189468192 CGCTGTGGGCAGTGAGGGGCTGG - Intergenic
985409065 4:189664492-189664514 CCATGTGTACAGTGAGGGGGAGG + Intergenic
985669475 5:1200235-1200257 CCATGTGGGCAGTGGGGGCAGGG + Intergenic
985898430 5:2764827-2764849 CCTTGGGTGTGGTGGCGGGCGGG - Intergenic
985981078 5:3464217-3464239 CTTTCTGTGCAGTGAGGGGAAGG - Intergenic
986631700 5:9780316-9780338 CTTTCAGTGCAGTGGAGGGCTGG - Intergenic
986878404 5:12139417-12139439 CACTGTGTGCGGTGGTGGGCAGG + Intergenic
987329357 5:16842274-16842296 CTTCTTGTGCAGTGGTGGGCTGG - Intronic
987769281 5:22279524-22279546 CCTGTTGTGCGGTGGGGGGAGGG - Intronic
988023164 5:25650338-25650360 CCTGTTGTGCGGTGGGGGGATGG - Intergenic
988114533 5:26867633-26867655 CCTGTTGTGCCGTGGGGGGAGGG - Intergenic
989464799 5:41742630-41742652 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
990360871 5:55018186-55018208 CCTGTTGTGCGGTGGGGGGAGGG + Intronic
990536863 5:56731849-56731871 CCTGTTGGGCGGTGGGGGGCTGG + Intergenic
991544235 5:67763529-67763551 CCTGATGTGGAGTGGGGGGAGGG + Intergenic
992295343 5:75321826-75321848 CTATGGGTGGAGTGGGGGGCGGG + Intergenic
993592491 5:89811532-89811554 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic
994087117 5:95771452-95771474 CCCTGTGTGCAGTGTGAGCCTGG + Intronic
995878045 5:116812004-116812026 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
996199233 5:120650476-120650498 CCTGTTGTGGAGTGGGGGGAGGG - Intronic
998001730 5:138631026-138631048 CATTGTGTGCTGTGTAGGGCTGG + Intronic
998505363 5:142667980-142668002 CTTTGTGAGCAGGGGTGGGCTGG - Intronic
998684794 5:144511909-144511931 CCTGGTGTGCAGTGCTAGGCGGG + Intergenic
998931198 5:147183348-147183370 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1001917461 5:175573865-175573887 CTGTGGGTGCTGTGGGGGGCAGG - Intergenic
1002737063 5:181401469-181401491 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1002747634 6:73310-73332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1003119769 6:3309833-3309855 CCTGCTGTGCAGTGAGGGGCTGG - Intronic
1003162337 6:3646789-3646811 CCATGTGCGAAGTGGGTGGCCGG + Intergenic
1003906839 6:10708679-10708701 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
1004491269 6:16118729-16118751 ACTGCTGTGCAGTGGGGGGTTGG + Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005424141 6:25683442-25683464 CCCTGTGTGCCCTGGGAGGCTGG + Intronic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006640070 6:35485311-35485333 CCTTGTGAGCCTTGGGGTGCGGG + Intronic
1007860779 6:44906018-44906040 CCTGTTGTGCGGTGGGGGGATGG + Intronic
1008899065 6:56590715-56590737 CCTAGTGTCCAGTGAAGGGCTGG + Intronic
1008995549 6:57654099-57654121 CCTGTTGGGGAGTGGGGGGCTGG + Intergenic
1009184075 6:60552868-60552890 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1009446961 6:63754340-63754362 CCTGTTGTGGAGTGGGGGGCTGG - Intronic
1010307098 6:74337892-74337914 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1012332302 6:98008279-98008301 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1012514941 6:100048415-100048437 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1013173019 6:107654655-107654677 TCCTCTGTGCAGTGGGGGCCTGG - Intronic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1013484660 6:110585183-110585205 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1013756831 6:113471808-113471830 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1015300395 6:131646546-131646568 CCTAGTCTGGAGTGGGAGGCAGG + Intronic
1015521552 6:134136521-134136543 CCTGCTGTGGAGTGGGGGGAGGG - Intergenic
1015957970 6:138617850-138617872 ACTTGTGCCCAGTGGGGTGCAGG + Intronic
1016523355 6:144971854-144971876 CCTGTTGAGGAGTGGGGGGCTGG - Intergenic
1016759623 6:147722955-147722977 CCTTGTGCTCAGTGTGGGTCTGG + Intronic
1017817705 6:158027464-158027486 CCTTGTGAGCAGCGGGGGATAGG + Intronic
1017949164 6:159121285-159121307 CCTTGGGTGCTCTGGGAGGCTGG + Intergenic
1019242159 6:170677039-170677061 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1019434955 7:1017799-1017821 CCTTGTGTGCAGTGGGGGGCGGG - Intronic
1019693657 7:2432482-2432504 CCTTCTGATCAGTGGGGGACTGG - Intronic
1019761289 7:2814792-2814814 GCTTGGGAGCAGTGCGGGGCAGG - Intronic
1020138378 7:5598996-5599018 GCTTCTGTGCAGTGGGGGTGGGG + Intronic
1020176014 7:5882673-5882695 CCTGGGGTGCAGTGGGGGCCAGG + Intronic
1020558778 7:9702485-9702507 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1022103148 7:27180938-27180960 CCTTGTGGGAAGTGGGGACCTGG - Intergenic
1022426148 7:30270664-30270686 GCCTGTGTGGTGTGGGGGGCAGG + Intergenic
1023065635 7:36374686-36374708 CCTGTTGTGGAGTTGGGGGCAGG - Intronic
1023330218 7:39107680-39107702 GCTTGTGTGTTGTAGGGGGCGGG - Intronic
1023841704 7:44101916-44101938 CCTGGGCTACAGTGGGGGGCTGG - Intergenic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1026099616 7:67373820-67373842 CCTGTTGTGGGGTGGGGGGCAGG - Intergenic
1026105328 7:67416523-67416545 CTCTTTGTGCAGTGGGAGGCTGG + Intergenic
1026409074 7:70100576-70100598 CCTATTGTGGGGTGGGGGGCTGG - Intronic
1026800693 7:73397985-73398007 CCTTGTTGGGGGTGGGGGGCGGG + Intergenic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1027540798 7:79462692-79462714 TATTGTGTGCAGTGCTGGGCAGG - Intergenic
1028138121 7:87243991-87244013 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
1028469028 7:91184832-91184854 CCCTGTATGCAGTTGGGGGCAGG + Intronic
1028513432 7:91650209-91650231 CCTGTTGTGGAGTGGGGGGAGGG + Intergenic
1028542092 7:91953809-91953831 TTTTGTGTGTGGTGGGGGGCGGG - Intronic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1029082812 7:97988346-97988368 CCTGGGGTGCAGTGGGGGCCAGG - Intronic
1029090600 7:98045134-98045156 CCTTGTGTGCAGAGTGCTGCAGG - Intergenic
1029643576 7:101836843-101836865 GCATGGGTGCGGTGGGGGGCAGG + Intronic
1029880336 7:103801573-103801595 CCTGTTGTGGGGTGGGGGGCAGG + Intronic
1030772510 7:113491779-113491801 CCTGTTGTGGGGTGGGGGGCGGG + Intergenic
1030879074 7:114853633-114853655 CCTTGTTCGTAGTGGGGTGCAGG + Intergenic
1032313581 7:130812825-130812847 CCTGTTGTGGAGTGGGGCGCTGG - Intergenic
1033038051 7:137893470-137893492 CTTTGTGTGCAGCTGGGGGTGGG + Intronic
1033054909 7:138042049-138042071 CCTTTCGTGGGGTGGGGGGCAGG + Intronic
1034056789 7:148043914-148043936 CCCTTTGTGCAATGAGGGGCAGG - Intronic
1034202174 7:149289571-149289593 CCCAGTGTGCTGTGGGAGGCAGG + Intronic
1034749117 7:153552284-153552306 CATTGTTTGCATTGGGGAGCTGG - Intergenic
1034855246 7:154539475-154539497 CCTGTTGTACGGTGGGGGGCAGG + Intronic
1035505959 8:131112-131134 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1035895178 8:3392099-3392121 CCTGTTGTGCGGTGGGGGGAGGG + Intronic
1036473357 8:9070870-9070892 CCATGTGTGCAGGGCCGGGCAGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1039140979 8:34387984-34388006 CCTGTTGTGGAGTGGGGGGCAGG - Intergenic
1040067023 8:43154342-43154364 CCTGCTGTGCGGTGGGGGGAGGG - Intronic
1040085170 8:43332439-43332461 CGTTTTGTGGAGTGGGGGGAGGG + Intergenic
1040658578 8:49542948-49542970 GCTTGTGTGGAGTAGGGGGAGGG + Intronic
1040766351 8:50916079-50916101 CCTGTTGTGGGGTGGGGGGCGGG - Intergenic
1041216043 8:55601188-55601210 CCTCTTGTGGGGTGGGGGGCTGG - Intergenic
1041581627 8:59466158-59466180 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1042200521 8:66276118-66276140 CCGTGTGTGCAGTATGGTGCTGG - Intergenic
1042601975 8:70507683-70507705 CCTATTGTGGGGTGGGGGGCGGG - Intergenic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042864029 8:73341115-73341137 CCTTGCCTGCAGAGAGGGGCTGG - Intergenic
1043633232 8:82363440-82363462 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1045205545 8:100035951-100035973 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1045572349 8:103381244-103381266 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1046657476 8:116911035-116911057 CCTTTTGTGGGGTGGGGGGAGGG + Intergenic
1047315375 8:123728123-123728145 CCTTGAGTGCTGTGTTGGGCTGG + Intronic
1048313480 8:133344459-133344481 GCATGTGTGCAGTGGGGGCATGG - Intergenic
1048324933 8:133431538-133431560 CCTTGTTTGCAGTGAGGTGTGGG + Intergenic
1048399893 8:134055398-134055420 ACTTGGATGCAGTGGTGGGCAGG + Intergenic
1048589025 8:135803818-135803840 CCTGTTGTGCAGTGGGGGCCGGG - Intergenic
1049204996 8:141359519-141359541 CCTTGTGTGGTGGGGGTGGCAGG - Intronic
1049421309 8:142517797-142517819 CCCCGTCTGCAGTGTGGGGCTGG + Intronic
1049594937 8:143479000-143479022 TATGGTGGGCAGTGGGGGGCTGG - Intronic
1049875272 8:145013982-145014004 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
1050461724 9:5883002-5883024 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1050552786 9:6762246-6762268 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1050597845 9:7221968-7221990 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1051238920 9:15031184-15031206 CCTGTTGTGGGGTGGGGGGCTGG + Intergenic
1052408493 9:28092539-28092561 CCTGTTGTGCGGTGGGGGGGAGG + Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1056048682 9:82745681-82745703 CCCTGTGTGTATTGGTGGGCTGG + Intergenic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1056769524 9:89466757-89466779 CCTTGTGTGCAGCAGGGAGGCGG + Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057120456 9:92568233-92568255 CCTGTTGTGCGGTGGGGGGAAGG - Intronic
1058090595 9:100801519-100801541 CCTGTTGTGAGGTGGGGGGCGGG + Intergenic
1058251106 9:102696912-102696934 CCTTTTGTGGGGTGGGGGGACGG + Intergenic
1058449730 9:105084851-105084873 CCTGTTGTGGTGTGGGGGGCTGG - Intergenic
1058629739 9:106974295-106974317 TCTTGGATGCAGCGGGGGGCAGG + Intronic
1058903815 9:109464911-109464933 CTTTGTGTGTAGTGAGGGGAAGG + Intronic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059923543 9:119184566-119184588 GCATGTGTGGAGTGGGGAGCAGG - Intronic
1060512675 9:124245225-124245247 ACTGGTGTGCATTGGTGGGCAGG + Intergenic
1060965548 9:127710579-127710601 CCTTGTGCGCTGTGGCGGCCAGG + Exonic
1061243178 9:129386241-129386263 CCTGGAGTGCATTTGGGGGCTGG - Intergenic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061263529 9:129492805-129492827 CTGTGTGTGCAGTGGAGGGTTGG - Intergenic
1061802928 9:133121893-133121915 CTGTGTGTGCAGTGGGGGAAAGG + Intronic
1061988230 9:134142896-134142918 TCCTGTGTGCAGTGGAGGGATGG + Intronic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1062265866 9:135686195-135686217 GCTTGTGTGCACTGTGGGCCTGG - Intergenic
1203602350 Un_KI270748v1:26261-26283 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1186055480 X:5645023-5645045 TCAGGTGAGCAGTGGGGGGCAGG + Intergenic
1187665457 X:21604309-21604331 CCTGCTGTGGAGTGGGGGGAGGG + Intronic
1187844235 X:23520272-23520294 CCTGTTGTGTAGTGGGGGGAGGG - Intergenic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1190065552 X:47239460-47239482 CCTTGCGTTCAATGGGTGGCTGG - Exonic
1190556488 X:51641031-51641053 ACTTCTGTGCAGTGGGGATCTGG - Intergenic
1190905661 X:54724991-54725013 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1192000971 X:67151068-67151090 CCTTTTGTGGGGTGGGGGGAAGG - Intergenic
1192003679 X:67186607-67186629 CCTTTTGTGGGGTGGGGGGAGGG - Intergenic
1192475807 X:71441815-71441837 CCTGTTGTGGGGTGGGGGGCTGG - Intronic
1192956371 X:76074660-76074682 CCTGTTGTGCGGTGGGGGGAGGG + Intergenic
1193051047 X:77100228-77100250 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1193507074 X:82357782-82357804 CCTGCTGTGGGGTGGGGGGCGGG + Intergenic
1193566525 X:83083818-83083840 CCTGTTGTGGAGTGGGGGGAGGG - Intergenic
1193728777 X:85077255-85077277 CCTGTTGTGGGGTGGGGGGCAGG - Intronic
1195125547 X:101806096-101806118 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1195471642 X:105236993-105237015 CCTGCTGTGCGGTGGGGGGATGG - Intronic
1196229650 X:113206759-113206781 CCTGTTGTGGGGTGGGGGGCTGG - Intergenic
1197871648 X:131067582-131067604 CCGTGTGTGTGGTTGGGGGCGGG - Intronic
1198926204 X:141799382-141799404 CCTGTTGTGGGGTGGGGGGCGGG - Intergenic
1199699656 X:150365683-150365705 CCTTGTGTGTGGTGGGGCGGAGG - Intronic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200037880 X:153345126-153345148 GCATGTGTGCAGTGGGGAGGAGG + Intronic
1200809998 Y:7474334-7474356 CCTGTTGTGCGGTGGGGGGAGGG - Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201344836 Y:12971633-12971655 CCTTTTGTGGGGTGGGGGGAGGG - Intergenic
1201460037 Y:14212212-14212234 CCTTTCGTGGGGTGGGGGGCTGG + Intergenic
1201699092 Y:16860135-16860157 CCTGTTGTGGGGTGGGGGGCAGG + Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic
1202273017 Y:23088530-23088552 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202293009 Y:23332152-23332174 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic
1202426014 Y:24722274-24722296 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202444775 Y:24947812-24947834 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic
1202591798 Y:26492921-26492943 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic