ID: 1019435823

View in Genome Browser
Species Human (GRCh38)
Location 7:1021657-1021679
Sequence CGACCTGCCGGGGTTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019435823 Original CRISPR CGACCTGCCGGGGTTCCCAG AGG (reversed) Intronic
900597034 1:3484868-3484890 ACACCTGCCGTGGTTCTCAGGGG - Intergenic
902582835 1:17419713-17419735 CGACTTGCCGGGGTGCAGAGGGG + Intronic
902880712 1:19370179-19370201 CGCCCTGAAGGGATTCCCAGTGG - Intronic
903338251 1:22638893-22638915 CACCTTGCCGGGGTTTCCAGAGG - Exonic
905180183 1:36160825-36160847 CAACCTGGCAGGCTTCCCAGAGG - Intronic
914834956 1:151199076-151199098 CGCCCTGCCGGGCTTACCTGAGG - Exonic
920062872 1:203239940-203239962 CTCCCTGCCTGGGTCCCCAGAGG - Intronic
923136612 1:231125389-231125411 CCACCTGCCGGCTTTCCTAGAGG - Intergenic
1068935017 10:62627106-62627128 TGCCCTGCCTAGGTTCCCAGGGG - Intronic
1075016750 10:118915322-118915344 AGAGCTGCCGGGGCTGCCAGTGG - Intergenic
1077161818 11:1116954-1116976 CGCCCTTCCTGGGGTCCCAGTGG - Intergenic
1082166567 11:48956261-48956283 CGAGGTGCCGGGATTGCCAGCGG - Intergenic
1104214278 12:126720790-126720812 ACACCAGCCGGTGTTCCCAGGGG + Intergenic
1107133592 13:36920554-36920576 CGGCCTGCCGGGGTGGCCCGGGG + Intronic
1121106208 14:91281575-91281597 CGAGGTGGCGGGGTTCCCTGTGG - Intronic
1121311526 14:92937919-92937941 GGAGCTGCCGGGGATCCCACCGG + Exonic
1121725241 14:96142756-96142778 CCACCTGCCTGGGTGGCCAGTGG - Intergenic
1122274155 14:100582696-100582718 CGGCCAGCCGGGGTTCCTACAGG - Intronic
1123119258 14:105909294-105909316 CCACCTGCTGGGGTTCCCCCTGG + Intergenic
1123218941 14:106839180-106839202 CGACGAGACTGGGTTCCCAGCGG - Intergenic
1124589075 15:31037074-31037096 CGAGCTGCAGGCGGTCCCAGTGG - Intronic
1125179191 15:36862109-36862131 TGTCATGCAGGGGTTCCCAGTGG - Intergenic
1126823702 15:52529036-52529058 CCACCTGCCCGGGGTCCTAGGGG + Exonic
1127706724 15:61554730-61554752 CCCCCTGCTGGGTTTCCCAGTGG - Intergenic
1130461091 15:84158622-84158644 TGGCATGCCGGGGTTCCCACAGG + Intergenic
1131150759 15:90046035-90046057 CGTCCAGCCAGGGTTCCCAGGGG + Intronic
1133420626 16:5643336-5643358 CCACCTTCCTGGGTGCCCAGAGG - Intergenic
1134109588 16:11506842-11506864 GGGCCTGCCTGGGTTGCCAGGGG - Intronic
1138586104 16:57971322-57971344 GGACCTGCCCGGCTTACCAGGGG + Intergenic
1141582663 16:85011139-85011161 CGACCTTCTGGAGTTCCTAGGGG - Intronic
1143173332 17:4942778-4942800 CAAGATGCCAGGGTTCCCAGAGG + Intronic
1145208769 17:20998003-20998025 CTTCCAGCCGGGCTTCCCAGAGG + Intergenic
1149441193 17:56675508-56675530 CGACCTGCTGGGGTGGCCAGAGG - Intergenic
1156465882 18:37347670-37347692 CCTCCTGCCAGGGTGCCCAGGGG - Intronic
1160310492 18:77785646-77785668 GGACCTGCAGGGGTCTCCAGGGG - Intergenic
1160622884 18:80182978-80183000 CGTCCTGACGTGGCTCCCAGTGG + Intronic
1160659274 19:290897-290919 CGTCCTGCCGGGGTAACCCGCGG + Intronic
1161979756 19:7624273-7624295 CCACCAGCCGGGGCCCCCAGAGG + Intronic
1163062016 19:14767767-14767789 GGACCTGTCTTGGTTCCCAGTGG + Intronic
1163470224 19:17492282-17492304 AGACATGACGGGCTTCCCAGTGG - Intronic
1163667150 19:18608540-18608562 CCACCTGCCAGGGGACCCAGAGG + Intronic
1164822220 19:31258918-31258940 AGACCTGCCGGGACTCACAGAGG - Intergenic
1165081020 19:33306008-33306030 AGGCCTGGCGGGGTTCTCAGAGG + Intergenic
1165344055 19:35232562-35232584 AGTCCTGCCGGGGGTCCCAGTGG + Intergenic
1165503728 19:36210957-36210979 CGACTTGAAGGGGCTCCCAGTGG + Intronic
1165657778 19:37549159-37549181 CGGCCTGCCTGTGTTCCCCGGGG + Intergenic
1168254317 19:55157522-55157544 CGACCTCCCGGGTTCCCAAGAGG - Intronic
924980341 2:214093-214115 CCACATGCTGGGATTCCCAGGGG - Intergenic
926035161 2:9630667-9630689 CGGCCTCCCCGGGTGCCCAGCGG - Intronic
931517603 2:63059125-63059147 TGACCTGCCGGGGTGCCCCGTGG + Intergenic
932212842 2:69946288-69946310 CCACCTTCCGGGGTACCTAGGGG - Intergenic
934487943 2:94735628-94735650 CCACCTGCCGGGATGCGCAGCGG + Intergenic
935658789 2:105447880-105447902 GGACATGCAGTGGTTCCCAGTGG + Intergenic
936713869 2:115162289-115162311 CCGCCCGCCGGGGTTCCCCGGGG - Intronic
938083834 2:128385267-128385289 CGGCCCGCCGTGGTTTCCAGAGG - Intergenic
938573828 2:132585710-132585732 CGAACTGCTGGGGTTCTCGGAGG + Intronic
948816844 2:240514880-240514902 CCACCTCCCTGGGTTACCAGTGG + Intronic
1171066222 20:22018036-22018058 CCACCTGCCCAGGTTCCCACTGG - Intergenic
1173504080 20:43573549-43573571 GGACCTGAAGGGGTCCCCAGTGG + Intronic
1175220264 20:57412604-57412626 GGACCTGCGGGGCTACCCAGGGG - Intergenic
1175987406 20:62770876-62770898 TGACCTGCCCGTGATCCCAGAGG + Intergenic
1176215252 20:63944848-63944870 CCACCTGCCAGGGTGCCCTGGGG - Intronic
1176215283 20:63944930-63944952 CCACCTGCCAGGGTGCCCTGGGG - Intronic
1178351660 21:31876004-31876026 CTGCATGTCGGGGTTCCCAGTGG - Intronic
1179201176 21:39222532-39222554 CAACATGAAGGGGTTCCCAGTGG + Intronic
1179314371 21:40228547-40228569 CCACCTGAAGGAGTTCCCAGTGG - Intronic
1179867818 21:44227319-44227341 GGACCTGCGGGGGCACCCAGAGG - Intronic
1180758076 22:18177107-18177129 GGAACTTCAGGGGTTCCCAGTGG + Exonic
1180768364 22:18360899-18360921 GGAACTTCAGGGGTTCCCAGTGG + Intergenic
1180777945 22:18501492-18501514 GGAACTTCAGGGGTTCCCAGTGG - Intergenic
1180801399 22:18633809-18633831 AGCCCTGCCAGGGTTCCCTGCGG + Intergenic
1180810669 22:18758803-18758825 GGAACTTCAGGGGTTCCCAGTGG - Intergenic
1180826241 22:18864123-18864145 GGAACTTCAGGGGTTCCCAGTGG + Intergenic
1181196817 22:21193058-21193080 GGAACTTCAGGGGTTCCCAGTGG - Intergenic
1181212711 22:21300066-21300088 GGAACTTCAGGGGTTCCCAGTGG + Intergenic
1185062234 22:48613002-48613024 CGCCCTGCCAGGGATGCCAGAGG - Intronic
1203229983 22_KI270731v1_random:101787-101809 GGAACTTCAGGGGTTCCCAGTGG + Intergenic
1203276383 22_KI270734v1_random:90029-90051 GGAACTTCAGGGGTTCCCAGTGG + Intergenic
953605611 3:44411377-44411399 AGGCCTGCCGGGATTCCCATGGG - Intergenic
961781505 3:129323406-129323428 CATCCTGCCGGGGTGCCCTGAGG - Intergenic
964013736 3:151921493-151921515 GAACCTGGAGGGGTTCCCAGAGG + Intergenic
968690456 4:1987334-1987356 TGCCCTGCCATGGTTCCCAGGGG + Intronic
968698239 4:2042845-2042867 GGTCCTCCCGGGCTTCCCAGGGG + Intronic
970429514 4:15975786-15975808 AGACTTGCCAGGGTTCCCACTGG + Intronic
975595415 4:76044908-76044930 CATCCAGCGGGGGTTCCCAGAGG + Intronic
976607939 4:87000016-87000038 CAACCTGAAGGGGCTCCCAGTGG + Intronic
983217452 4:165015485-165015507 CAACCTGCCGGAGTCACCAGTGG + Intergenic
984431913 4:179661095-179661117 CAACCAGCCGGGGATCACAGAGG - Intergenic
985657601 5:1140227-1140249 GGATCTGCCTGGGTTCCCATGGG - Intergenic
993272286 5:85811456-85811478 GGACCAGCTGGGGTTCCCTGTGG + Intergenic
995312210 5:110726641-110726663 CAACCAGCCTTGGTTCCCAGCGG - Exonic
996290976 5:121852071-121852093 CGATCTGCCTGGGGTCCAAGGGG - Exonic
997625194 5:135326723-135326745 CGACCTGCCTGAGATCCCACAGG + Intronic
999474403 5:151885281-151885303 CTAGCTGCTGGGGTTCCCACAGG + Intronic
1007947007 6:45835929-45835951 GGACATGCCTGGCTTCCCAGAGG - Intergenic
1011736170 6:90313022-90313044 CGCCCACCCTGGGTTCCCAGTGG - Intergenic
1012401082 6:98843412-98843434 TGAGATGCCGGGGTGCCCAGAGG - Intergenic
1019435823 7:1021657-1021679 CGACCTGCCGGGGTTCCCAGAGG - Intronic
1019538042 7:1538975-1538997 CGTCCTGAGGGGCTTCCCAGGGG - Intronic
1019706600 7:2499943-2499965 CGACCTGCAGGGGTGCCGAGAGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1023035762 7:36130234-36130256 CTACCTGTCAGGGGTCCCAGTGG - Intergenic
1030033572 7:105389233-105389255 CGACCGGCCGGGGTGCGGAGGGG - Intronic
1035278004 7:157759387-157759409 CCACCTGCCGGAGTTCCCGCAGG - Intronic
1035520432 8:272000-272022 CGACCTGCGGGGCGCCCCAGAGG + Intergenic
1039875128 8:41578434-41578456 CCACCCGCCGGGGATCCCCGGGG - Intronic
1049219610 8:141422874-141422896 CCATCTGCCAGGGTTGCCAGCGG - Intronic
1056557658 9:87703223-87703245 CCCCCTGCCTGGGCTCCCAGGGG - Intronic
1061250928 9:129426007-129426029 CCAGCTGCCTGGGTTCCCAGGGG - Intergenic
1061310019 9:129756008-129756030 CTACCTGCAGGGGTTCCCACGGG - Intergenic
1061862770 9:133476412-133476434 CCACTTTCCGGGGTTCACAGGGG - Intronic
1197790345 X:130248366-130248388 TCTCCTGCCGGGATTCCCAGAGG - Intronic