ID: 1019436229

View in Genome Browser
Species Human (GRCh38)
Location 7:1023586-1023608
Sequence GAGAACATGACGAAGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019436223_1019436229 -5 Left 1019436223 7:1023568-1023590 CCTTCCCACTGGGCCCTGGAGAA 0: 1
1: 0
2: 4
3: 41
4: 339
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436225_1019436229 -10 Left 1019436225 7:1023573-1023595 CCACTGGGCCCTGGAGAACATGA 0: 1
1: 0
2: 1
3: 26
4: 253
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436218_1019436229 8 Left 1019436218 7:1023555-1023577 CCAACTTCCAACTCCTTCCCACT 0: 1
1: 0
2: 3
3: 70
4: 615
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436217_1019436229 12 Left 1019436217 7:1023551-1023573 CCATCCAACTTCCAACTCCTTCC 0: 1
1: 1
2: 3
3: 70
4: 468
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436215_1019436229 30 Left 1019436215 7:1023533-1023555 CCTACTCCACATTTCTCTCCATC 0: 1
1: 0
2: 2
3: 65
4: 763
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436216_1019436229 24 Left 1019436216 7:1023539-1023561 CCACATTTCTCTCCATCCAACTT 0: 1
1: 0
2: 1
3: 55
4: 479
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436221_1019436229 1 Left 1019436221 7:1023562-1023584 CCAACTCCTTCCCACTGGGCCCT 0: 1
1: 0
2: 2
3: 43
4: 572
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data
1019436224_1019436229 -9 Left 1019436224 7:1023572-1023594 CCCACTGGGCCCTGGAGAACATG 0: 1
1: 0
2: 1
3: 23
4: 184
Right 1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019436229 Original CRISPR GAGAACATGACGAAGACTGT GGG Intronic
No off target data available for this crispr