ID: 1019438250

View in Genome Browser
Species Human (GRCh38)
Location 7:1032656-1032678
Sequence CGGGTGGCTGCAGCCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 3, 2: 2, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019438250_1019438264 19 Left 1019438250 7:1032656-1032678 CCCTCAGAGGCTGCAGCCACCCG 0: 1
1: 3
2: 2
3: 23
4: 205
Right 1019438264 7:1032698-1032720 TCAGGTGACAGTGGTGCCCTTGG No data
1019438250_1019438261 10 Left 1019438250 7:1032656-1032678 CCCTCAGAGGCTGCAGCCACCCG 0: 1
1: 3
2: 2
3: 23
4: 205
Right 1019438261 7:1032689-1032711 CAGGCACCCTCAGGTGACAGTGG 0: 1
1: 4
2: 3
3: 24
4: 240
1019438250_1019438258 1 Left 1019438250 7:1032656-1032678 CCCTCAGAGGCTGCAGCCACCCG 0: 1
1: 3
2: 2
3: 23
4: 205
Right 1019438258 7:1032680-1032702 CCACACCGCCAGGCACCCTCAGG No data
1019438250_1019438252 -9 Left 1019438250 7:1032656-1032678 CCCTCAGAGGCTGCAGCCACCCG 0: 1
1: 3
2: 2
3: 23
4: 205
Right 1019438252 7:1032670-1032692 AGCCACCCGCCCACACCGCCAGG No data
1019438250_1019438265 20 Left 1019438250 7:1032656-1032678 CCCTCAGAGGCTGCAGCCACCCG 0: 1
1: 3
2: 2
3: 23
4: 205
Right 1019438265 7:1032699-1032721 CAGGTGACAGTGGTGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019438250 Original CRISPR CGGGTGGCTGCAGCCTCTGA GGG (reversed) Intronic
900139763 1:1134797-1134819 AGAGGGGCTGCAGCCTCAGATGG - Intergenic
900463651 1:2813328-2813350 CGGGTGGGTGCAGGCTCGGTGGG + Intergenic
900567611 1:3341321-3341343 CCAGGGCCTGCAGCCTCTGAAGG - Intronic
900650794 1:3729251-3729273 GGGGTGGCCGCAGCCTCAGGAGG - Intronic
901511006 1:9717999-9718021 GCGGTGCCTGCAGCCTGTGAGGG + Intronic
901731604 1:11284269-11284291 GGGGTGTCTGAAGGCTCTGACGG + Intronic
902618083 1:17634788-17634810 AGGGTGGCTGCAGCCTCTCCAGG + Intronic
902715375 1:18269165-18269187 GGGGTGGCTGCAGACTCTGATGG + Intronic
902770523 1:18643061-18643083 CGGGTCGCTACAGCCTCGGGAGG + Intronic
903665911 1:25007359-25007381 CAGGTGGCAGGAGCCACTGAAGG + Intergenic
903911643 1:26731232-26731254 AGGGTGGCTGCTGCTGCTGAGGG - Exonic
904181387 1:28668947-28668969 CGGGGGGCTGCTGCCTCCGCGGG + Intronic
905024362 1:34839735-34839757 GGGGTGGCCCCAGCCTCTCATGG - Intronic
907668278 1:56452062-56452084 AGGGTGGCTCCAGCATCTGTTGG + Intergenic
916240180 1:162631839-162631861 CAGTTGGCTGCTGCCTCTGAGGG - Intronic
916822896 1:168417017-168417039 CTGGTGGCTGCAGCATTAGAAGG - Intergenic
918708307 1:187696203-187696225 TGGGCTGCTGCAGCCTCTGCAGG + Intergenic
922841972 1:228650176-228650198 CATGGGGCTGCAGCCGCTGATGG - Intergenic
923045228 1:230350743-230350765 GGGGTGGCAGCAGCCTCTCCAGG + Intronic
923681259 1:236120571-236120593 GTGGTGGCTGCATCCTCTCATGG + Intergenic
923724133 1:236491790-236491812 CCGGTGGCTGCTGCCCCTCAGGG + Intergenic
923975282 1:239255807-239255829 CGGGTGGGTGCAGGCTCGGTGGG - Intergenic
924706551 1:246507202-246507224 CGGGAGGATGGAGCCGCTGAAGG - Exonic
1065071002 10:22023489-22023511 CGGGTGTCTGAAGCCTAAGAGGG + Intergenic
1067404584 10:46010077-46010099 GGGATGGCTGGAGCCTCGGAAGG + Intronic
1071490366 10:86132063-86132085 CAGGAGGCAGCAGGCTCTGAGGG + Intronic
1072241115 10:93496494-93496516 CGATTGGCTGCCGCCTTTGAAGG - Intergenic
1072436076 10:95415722-95415744 CGGGTGCCCGCAGCCTCCAAGGG + Intronic
1073050603 10:100664673-100664695 CTGGTTCCTGCAGCCTCTGAGGG - Intergenic
1073468885 10:103710632-103710654 AGGGTGTGTGCAGCCTCTCAGGG + Intronic
1076187794 10:128462457-128462479 CTGGTGGCTGCAGGATCAGAGGG - Intergenic
1076679831 10:132165931-132165953 CTGGGGGCTGGAGCCTCAGAGGG + Intronic
1076768914 10:132652348-132652370 CGTGTGGCTGCAGCCCCAGGAGG + Intronic
1077037373 11:501991-502013 CGGGTGGCGGCTCCCTCTGAAGG - Intronic
1077405485 11:2380658-2380680 CAGGTGCCAGCCGCCTCTGATGG - Intronic
1077514715 11:2994505-2994527 CGGGTGGGTGGATCCTCTGAGGG + Intergenic
1080381464 11:31776060-31776082 AGGGTGGCTTCAGCCTGAGAGGG + Intronic
1085784749 11:79439869-79439891 CTGGCGGCTGCAGCCTCAGTTGG + Intronic
1087557548 11:99740691-99740713 TGAGTTGCTGCAACCTCTGATGG - Intronic
1088693016 11:112343984-112344006 AGGCCTGCTGCAGCCTCTGAAGG + Intergenic
1088881251 11:113975179-113975201 TGTGAGGCTGCAGCCTCAGAAGG + Exonic
1089011960 11:115138718-115138740 CAGGTGCCTTCAGCCTCTGCGGG + Intergenic
1089309653 11:117549205-117549227 TGAGTGGCTGCAGCCTCCAAAGG + Intronic
1090367232 11:126216915-126216937 CAGGTGGCTGGAGCCTATGCTGG + Intronic
1090904811 11:131065844-131065866 CATGTGGCTGCAGCCCCGGAAGG + Intergenic
1091810116 12:3389940-3389962 TGGGTGGCTGCATCCGCTGCAGG + Intronic
1091924763 12:4336534-4336556 CGGTTGGCTGGACACTCTGAAGG - Intronic
1095669692 12:44844048-44844070 CTTGTTGCTGCAGCCTCTGGAGG + Intronic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1099673646 12:85728672-85728694 CGGCAGGCTCCAGGCTCTGAGGG - Intergenic
1103711761 12:122918031-122918053 ACCGTGGCTGCAGCCTCTGCAGG + Intergenic
1103863171 12:124030169-124030191 CGGGTTTGTGCAGGCTCTGAAGG + Intronic
1104570081 12:129917515-129917537 CTGGTGCCTGCAGTTTCTGAAGG - Intergenic
1107345724 13:39458622-39458644 CGGCTCACTGCAGCCTCTCATGG - Intronic
1108615489 13:52128618-52128640 CCGGTGTCTGCAGCCTCTCCTGG - Intronic
1112076182 13:95915845-95915867 GGTGTGGCTGAAGCCTCTGCAGG - Intronic
1112237050 13:97645973-97645995 CGGGTGGGGGCAGCCTCTAAAGG - Intergenic
1113099518 13:106702197-106702219 CTGGTGGGTGCAGCTTCTTAGGG - Intergenic
1113459233 13:110470312-110470334 CAGGTTCCTGCAGCCTCTGCTGG + Intronic
1113891768 13:113739715-113739737 CGCGGGGCTGCAGTGTCTGACGG + Intergenic
1114793076 14:25681152-25681174 CCGGTGGGTGCGGGCTCTGAGGG - Intergenic
1118325119 14:64775223-64775245 CGGGAGGCTGCAGCGACTGAGGG - Exonic
1120853908 14:89196460-89196482 TGGGTGGCTGCAGACTTGGAAGG + Intronic
1121280670 14:92695030-92695052 GCGGTGGCTGCAGCCTTTCATGG - Intergenic
1122133671 14:99620478-99620500 TGGCTGGATCCAGCCTCTGAGGG + Intergenic
1122378889 14:101287497-101287519 AGGGTGGCTGCTGAGTCTGAGGG - Intergenic
1122788676 14:104175426-104175448 CTGGGGGATGCAGCCTCTGGTGG - Exonic
1122858490 14:104571613-104571635 GGGGCTGCTGCAGCCTCTGCTGG - Intronic
1124374915 15:29123844-29123866 CTGGAGGCTGCAGCCCCTGGAGG - Intronic
1125987394 15:44067573-44067595 CGTGTTGCTGCATCCTCAGAGGG + Intronic
1127288040 15:57547524-57547546 TGGGTGGCTGCAGCTCCTGCAGG - Exonic
1128187520 15:65655606-65655628 CGGGTGACTGCAGATTATGATGG + Exonic
1130632653 15:85584299-85584321 CGGGTGTCGGCAGCCTCTGCAGG - Intronic
1130982694 15:88823640-88823662 GGGGTGGCTGCAGCCGTGGATGG - Intronic
1131095926 15:89654462-89654484 AAGGTGGCTGCAGCCTCAGCCGG - Intronic
1131143870 15:89999758-89999780 CGGGAGGCTGCAGTCACTGGGGG + Intergenic
1131726781 15:95235055-95235077 CGAGTGCCTGCAGCCTCTCCAGG + Intergenic
1132460922 16:54114-54136 CGGGCGCCGGCAGCCTCCGAAGG + Intronic
1132934548 16:2474054-2474076 CGCGTCGCTGCAGCCTCCGCAGG - Exonic
1137676041 16:50304353-50304375 GGGGTGGCTGCTGGCTCTGCGGG - Exonic
1138513082 16:57519926-57519948 TGGGTGGCTGCGCCCTCTGGTGG + Intronic
1138793604 16:59939985-59940007 CTGGTGGCTGCAGTCTTGGAGGG - Intergenic
1141636518 16:85316851-85316873 GGCGTGGCTGCAGCCCCTCAGGG + Intergenic
1143110046 17:4548038-4548060 CAGGATGCTGCAGACTCTGAAGG - Exonic
1143339128 17:6195266-6195288 CAGGTCTCTGCATCCTCTGAGGG + Intergenic
1143633827 17:8153163-8153185 TGGGTGGCTGCGTCCTCTGGAGG - Intronic
1144960214 17:19040426-19040448 CTGGAAGCTGCAGCCTCTGTGGG + Intronic
1144974946 17:19134098-19134120 CTGGAAGCTGCAGCCTCTGTGGG - Intronic
1145013302 17:19381930-19381952 CGGGGGGCTGGGGCCTCTGGGGG + Exonic
1147327124 17:39674901-39674923 CGGGGGGCTGCAGCCTCCACAGG + Intronic
1147961334 17:44169456-44169478 CAGGTGGCTGCAGCAGCTGAAGG + Intergenic
1150445665 17:65225418-65225440 CGGGAGGGTGCAGCCCCTGGGGG + Exonic
1151334496 17:73431999-73432021 CGGGTGCCAGCTGCCTCTGAGGG - Intronic
1151743666 17:76000641-76000663 CTGTGGGCTGCAGCCTCTCAGGG + Intronic
1154316898 18:13311386-13311408 CGGGTGGCAGGAAGCTCTGATGG + Intronic
1158949270 18:62476846-62476868 CTTGTTGCTGCAGCCTCTGGAGG + Intergenic
1161511876 19:4676509-4676531 CAAGTGGCTGCAGCCTCCGCGGG - Exonic
1161584861 19:5100016-5100038 CGGATGGGTGCAGCCTTCGAAGG - Intronic
1162895571 19:13763126-13763148 CGGGGGTCTGCAGTCTGTGAGGG - Exonic
1164509015 19:28882604-28882626 CCTGTGGCTGCAACCTCAGAAGG + Intergenic
1165942689 19:39423158-39423180 CTGGTGGCTGGAGCCTCAGCTGG - Exonic
1168552261 19:57306290-57306312 TGGATGGCGGCATCCTCTGAAGG - Intergenic
925386279 2:3463942-3463964 CTGGTGAGTGCAGCCTCTGTTGG + Intronic
927515346 2:23668861-23668883 GGGGTGGGTGCTGCCTCTGGAGG - Intronic
927651717 2:24917507-24917529 CTGGTCTCTGCAGCCCCTGAGGG + Intronic
928723137 2:34142829-34142851 CGGGTGGATGCAGGCTCAGCGGG - Intergenic
929956678 2:46463736-46463758 GGGGTGGGTGCAGGCTCTGCTGG + Intronic
934077760 2:88442383-88442405 CGAGAGGCTGCAGCTTCTGCTGG - Intergenic
937863352 2:126730416-126730438 AGGGTTACGGCAGCCTCTGATGG + Intergenic
938756008 2:134379579-134379601 TGGGTGAGTGCTGCCTCTGATGG + Intronic
948368495 2:237473570-237473592 CGGGCAGCTGCAGCCACTGCAGG - Intergenic
948807533 2:240459465-240459487 CTGGTGACAGGAGCCTCTGAGGG - Intronic
1169198869 20:3697949-3697971 GGGGTGGCTGCAGCACCTGTGGG - Exonic
1170569525 20:17625055-17625077 TGGGAAGCTGCAGCCTCTGCAGG + Intronic
1170969733 20:21105442-21105464 CCGGGGGCTGCAGCCTCAGAGGG - Intergenic
1171375597 20:24692223-24692245 ATGGTGGCAGAAGCCTCTGATGG - Intergenic
1172055691 20:32152773-32152795 GGGGAGGCGGCAGCCTCTGGAGG - Intronic
1172587236 20:36093294-36093316 CTTGTGGCTGCAGCCTGTGGCGG + Intronic
1174839027 20:53884387-53884409 CAGCTGGCTGCTGCCTCTGTAGG + Intergenic
1175542070 20:59754259-59754281 TCGGCTGCTGCAGCCTCTGAGGG - Intronic
1175733533 20:61370263-61370285 GGGGTGGCTGTTGCCTGTGAAGG + Intronic
1176061943 20:63176292-63176314 CGGGTGCCGGCAGCCTCAGCAGG - Intergenic
1176088691 20:63309514-63309536 GGGGGGGCTGCAGCCTGTGCGGG - Intronic
1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG + Intergenic
1176414995 21:6468945-6468967 AGGCTGGCTGAAGGCTCTGAGGG - Intergenic
1177440172 21:21112558-21112580 GTAGTGGCTGCAGCCTTTGACGG - Intronic
1178367403 21:31999064-31999086 CAGATGGCTGCAGACTCTGATGG - Exonic
1178916481 21:36708125-36708147 CTGGTGGCTGCAGCGCCAGATGG - Intronic
1179173629 21:38991789-38991811 AGGGTGGCTGCAGCCAGAGAAGG - Intergenic
1179690495 21:43077277-43077299 AGGCTGGCTGAAGGCTCTGAGGG - Intergenic
1179792702 21:43764664-43764686 CGGGTGGCAGCAAACCCTGAAGG - Intergenic
1179856866 21:44166396-44166418 GGGTTTGGTGCAGCCTCTGATGG - Intergenic
1181648803 22:24247727-24247749 GGGGTCGCTGCACCCTCTGGTGG + Intergenic
1182051066 22:27313197-27313219 TGAGGGGCTGCAGCCTCTCAGGG - Intergenic
1182681760 22:32084946-32084968 AGGGTGGCTGCATCCTGTGTGGG + Exonic
1183018346 22:35008059-35008081 AGGGTGGCTGCATCCTTTGTGGG - Intergenic
1183723234 22:39574300-39574322 CCGGTGGCTGCAGCCGCTGCTGG + Intronic
1184880893 22:47303571-47303593 CGTGTGGCTGCGGCCGATGATGG + Intergenic
1185014637 22:48335766-48335788 CGGGTGGCTTCAGCACCAGAAGG + Intergenic
1185146499 22:49139889-49139911 CGGGGTGCGGCAGCCTCTGTGGG - Intergenic
1185413196 22:50696789-50696811 CGGGTCGCTGCGCCCTCTGTCGG + Intergenic
950543604 3:13626405-13626427 GGGGACTCTGCAGCCTCTGATGG + Intronic
950705503 3:14777446-14777468 TGGGTGGCTGCAGCCTGAGGAGG + Intergenic
951709037 3:25571135-25571157 TGGGTGGCACCAGCTTCTGAAGG + Intronic
952834681 3:37592736-37592758 AGGGTGGATGGTGCCTCTGAAGG + Intronic
953770566 3:45776112-45776134 CAGGTGGCTGGAGCCCCTGAAGG + Intronic
954693011 3:52405776-52405798 AGGGCCCCTGCAGCCTCTGAGGG - Exonic
962309785 3:134317253-134317275 GTGGTGGCGCCAGCCTCTGAAGG + Intergenic
963256060 3:143145982-143146004 GGGCTGGCTGCTGCTTCTGAGGG + Intergenic
965286519 3:166826166-166826188 AGGGTGGCAGCAGCCGCTGCAGG + Intergenic
968289196 3:197525742-197525764 CTGCTGGCTGCAGACTCTGGTGG + Intronic
968478714 4:824809-824831 GGGGTGTCTGAAGCCTCTGCAGG + Intronic
968660049 4:1795083-1795105 CGGGAGGCTGCAGCCGCCGACGG - Intronic
969038923 4:4278550-4278572 GGGGTCACAGCAGCCTCTGAAGG - Intronic
969246027 4:5933533-5933555 CAGGTGGCTGGAGTCCCTGAGGG + Intronic
969508881 4:7605844-7605866 CCACTGGCTGCAGCCTCTGCTGG - Intronic
971575137 4:28263287-28263309 CGGGCAGCTGCATCTTCTGAGGG - Intergenic
978415163 4:108467303-108467325 CAGATGGCTAGAGCCTCTGAAGG + Intergenic
980891938 4:138824905-138824927 AGGGTGACTGCAGCCTGGGAAGG - Intergenic
983345808 4:166524378-166524400 AGGGTGGCAGCAGCCGCTGCAGG - Intergenic
984768776 4:183419759-183419781 GGGGTGGCTTCAGCAGCTGAGGG - Intergenic
984844589 4:184098740-184098762 CAGCTGGCTGCAGCCTCTGTAGG - Intronic
986206186 5:5627454-5627476 AGTGTGGCTGCAGCCACGGAGGG + Intergenic
988566025 5:32320603-32320625 TGGGTGGCTGCAGCCACTCCTGG + Intergenic
990985585 5:61638346-61638368 CTGGTTGCTGCCGTCTCTGAAGG + Intronic
991111267 5:62902202-62902224 TGGGAGGATGGAGCCTCTGAAGG + Intergenic
992217727 5:74542482-74542504 CAGGTGGCAGCAGCCATTGAGGG + Intergenic
992957227 5:81922439-81922461 CGGGTGGCAGCAGCCTGGGCAGG + Intergenic
994725810 5:103434228-103434250 TGGGTGGCTGCAGCCGCACAGGG - Intergenic
996155627 5:120095310-120095332 CTGTTGGCTGCAGCTGCTGAGGG + Intergenic
996327230 5:122288599-122288621 TGGGTGGCTGGAGCCTATGCTGG - Intergenic
998304743 5:141062657-141062679 GTGGTGGCTGCAGCCTGGGAAGG + Intergenic
999268420 5:150282132-150282154 TGGGTGGCTGCAGCCTCAGGCGG - Intronic
999471551 5:151859237-151859259 GGGGTGGCAGTAGACTCTGAAGG + Intronic
1001294439 5:170489165-170489187 TGGGAGGCTGCAGGCACTGAAGG + Intronic
1001656803 5:173357170-173357192 CGGGAGGCAGCGGCCTTTGATGG + Intergenic
1001843541 5:174901577-174901599 CGGGTGGCTGTAGGCTCAGCGGG + Intergenic
1002099768 5:176851620-176851642 TGGCGGGCTGCAGCCTCTGAGGG + Intronic
1002385193 5:178860766-178860788 CGGGTCGCTGCTGCCACTGCGGG + Intronic
1003323831 6:5076908-5076930 AGGGTGGCTGCAACCACTCAAGG + Intergenic
1004690455 6:17988044-17988066 CGGGTGGCAGCGGCCCCAGAAGG - Intergenic
1006389193 6:33748680-33748702 GGGGAGGCTGCAGCCTGTGTGGG + Intergenic
1006474262 6:34244756-34244778 CGGGTGGGGCCAGCCTCTGGGGG + Intronic
1006898353 6:37484666-37484688 GGGGTGTCTGCAGCCTCTGGGGG + Intronic
1007335773 6:41154046-41154068 CGGGTGCCTGCAGCACCTCAGGG + Exonic
1008439897 6:51520854-51520876 TGGTGGGCTGCAGCCTCCGAGGG - Intergenic
1011751465 6:90459089-90459111 TGGGTGGAGGCAGCCTCTGAGGG + Intergenic
1012988939 6:105904950-105904972 CGGGTGGCTGGAGCCTGTCTGGG - Intergenic
1013290625 6:108716246-108716268 CTGGTGTCTGCAGCCTCTGAAGG - Intergenic
1013734500 6:113209589-113209611 TGTTGGGCTGCAGCCTCTGAAGG + Intergenic
1014272401 6:119349272-119349294 CCGCTGGCTGCAGCCCCTGCGGG + Exonic
1014542972 6:122698630-122698652 GAGGTCGCTGAAGCCTCTGAGGG + Intronic
1018300238 6:162394481-162394503 TGTGTGGCTGCAGGCTATGAAGG + Intronic
1019438178 7:1032432-1032454 TGGGTGGCTGTGGCCTCTTAGGG - Intronic
1019438196 7:1032488-1032510 CGGGTGGCTGCGGCCTCTGAGGG - Intronic
1019438214 7:1032544-1032566 CGGGTGGCTGCGGCCTCTGAGGG - Intronic
1019438232 7:1032600-1032622 CGGGTGGCTGCGGCCTCTGAGGG - Intronic
1019438250 7:1032656-1032678 CGGGTGGCTGCAGCCTCTGAGGG - Intronic
1023109680 7:36796617-36796639 CAGGTGGCTGGAGCCTCTCCTGG - Intergenic
1027733316 7:81903099-81903121 GGGCTTGCTGCAGCCACTGAGGG + Intergenic
1029039532 7:97558048-97558070 GGGGTGGCTGCAGTCTGTGCAGG + Intergenic
1031063006 7:117073079-117073101 AGGCTGGCTTCAGCCTTTGAAGG + Intronic
1032516351 7:132508954-132508976 CGGGTGGCAGCAGCCCCAGGAGG + Intronic
1033114166 7:138610740-138610762 AGGGTGGCTGGAGCCTCATAAGG - Intronic
1034272705 7:149811151-149811173 CAGGAGGGTGCAGCCTCAGAGGG - Intergenic
1034534838 7:151720180-151720202 CGGCTGTCTGCAGCCACTGGAGG - Intronic
1034788294 7:153945073-153945095 CGGCAGACTGCAGGCTCTGAAGG + Intronic
1035109094 7:156465356-156465378 CGGGTGGCTGCAGGTGCTGTGGG - Intergenic
1035400172 7:158559632-158559654 GGGGTGATTGCAGCCTCAGAGGG - Intronic
1035482537 7:159198818-159198840 TGGGAGGCTGCTGCCTCTAACGG - Intergenic
1035567429 8:650701-650723 GGGGTGGCTGCACCCTCTTCAGG - Intronic
1038271214 8:26077774-26077796 AGGGTGGCTCGGGCCTCTGACGG - Intergenic
1039545616 8:38408866-38408888 CAGATTGCTGCAGCCTCTGCAGG - Intronic
1041179725 8:55235073-55235095 TTGGTTGCTGGAGCCTCTGAGGG + Intronic
1042395936 8:68292423-68292445 CGGGTGGCTGCAGCGTCACCCGG - Intergenic
1043958184 8:86386918-86386940 CTTGTTGCTGCATCCTCTGAAGG + Intronic
1047255116 8:123208299-123208321 CTGGTGGCTACAGCTTCAGATGG - Exonic
1047752754 8:127894229-127894251 GGGGTGCCTGGAGCCTCTGATGG + Intergenic
1048787381 8:138064282-138064304 AGGGTGGCTGCAGCAACAGAGGG - Intergenic
1049473104 8:142785000-142785022 CTGGGGGCTGCATCCTCTGTGGG + Exonic
1049473109 8:142785020-142785042 GGGGTGGCTTCATCCTCTGTGGG + Exonic
1049625002 8:143615950-143615972 CTGGTGGGGGCAGCCCCTGAGGG - Intronic
1052122769 9:24738586-24738608 CGGGTGGCCGCAGGCTCCGTGGG + Intergenic
1056836898 9:89962754-89962776 AGGGTGGCTGCAGCTTCTATCGG + Intergenic
1060128555 9:121074131-121074153 GGAGCGGGTGCAGCCTCTGATGG + Intergenic
1061234438 9:129334409-129334431 CGGGTTGCTGCAGCCCCGGAAGG - Intergenic
1061930848 9:133832371-133832393 AGGGTGGCTGCAGACTCTGCTGG + Intronic
1062627021 9:137448005-137448027 GGGGAGGCTGCAGTCTCGGAGGG - Exonic
1203401862 Un_KI270519v1:112387-112409 CAAGTGGTTGCAGCCTCTGTTGG + Intergenic
1186502639 X:10064480-10064502 GGGGCGGCTGCAGGGTCTGAAGG + Intronic
1187346585 X:18470832-18470854 CGTGTAGCTGCTGCCTCTGTGGG + Intronic
1193690405 X:84634629-84634651 GGGCTTGCTGCAGCCTCTGTTGG - Intergenic
1196783145 X:119400231-119400253 GGGGAAGCTGCAGCCTCTGTCGG - Intronic