ID: 1019440493

View in Genome Browser
Species Human (GRCh38)
Location 7:1043815-1043837
Sequence GGGCCGAGTGGAACACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019440493_1019440497 1 Left 1019440493 7:1043815-1043837 CCTGCTGGTGTTCCACTCGGCCC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1019440497 7:1043839-1043861 CAGCTCACAGCAAGTCTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019440493 Original CRISPR GGGCCGAGTGGAACACCAGC AGG (reversed) Intronic
901792993 1:11664287-11664309 GGGCCGAGAGGGACGGCAGCGGG + Intronic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
902597799 1:17520985-17521007 GAGCCGAGTGGAAAAGCAGGGGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
909231300 1:73093751-73093773 TGACCCAGTGAAACACCAGCTGG - Intergenic
910418491 1:87028321-87028343 AGGGCGATTGGAAGACCAGCAGG - Intronic
913984463 1:143552431-143552453 GGAGCAACTGGAACACCAGCTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
924027224 1:239847045-239847067 GGACAGAGTAGAACACCAGAAGG - Intronic
1071115499 10:82214368-82214390 GGACAGACTGGAACACCTGCTGG - Intronic
1072513398 10:96151527-96151549 GGCCTGAGTGAAAAACCAGCTGG - Exonic
1074503320 10:114044864-114044886 GGGCCTCGCGGAACACCCGCAGG - Exonic
1084169183 11:67392251-67392273 GGGGCGGGTGGGACTCCAGCCGG + Intronic
1085412804 11:76301564-76301586 GGGCAGTGTGGAACACCAGTAGG + Intergenic
1092497559 12:9012118-9012140 TGACCTAGTGAAACACCAGCTGG + Intergenic
1094419719 12:30257784-30257806 TGACCTAGTGAAACACCAGCGGG + Intergenic
1095291093 12:40481188-40481210 GGGACAACTGGAGCACCAGCTGG + Exonic
1095291313 12:40483165-40483187 GGTACAACTGGAACACCAGCTGG + Exonic
1095291677 12:40485704-40485726 GGGACAATTGGATCACCAGCTGG + Exonic
1095292229 12:40489481-40489503 GGGACAATTGGATCACCAGCTGG + Exonic
1096934230 12:55253470-55253492 GGGCCAAGTGGAAAACCATATGG - Intergenic
1102238667 12:111310291-111310313 AGGCTGGGGGGAACACCAGCAGG - Exonic
1107793512 13:44026692-44026714 GGGGAGAGGGGCACACCAGCTGG - Intergenic
1108447985 13:50528198-50528220 GGGCTCAGTGGAACACCTGAAGG + Intronic
1108857975 13:54819573-54819595 TGACCGAGTGAGACACCAGCTGG + Intergenic
1113311964 13:109140751-109140773 GGGTCGGGGGGAACACCAGCAGG - Exonic
1122118196 14:99537941-99537963 GGGCTCCCTGGAACACCAGCTGG + Intronic
1122296733 14:100709974-100709996 GGGCCGGGTAGACCACCAGGTGG + Intergenic
1127497036 15:59523148-59523170 GGGAGGCGGGGAACACCAGCTGG + Exonic
1133802192 16:9092534-9092556 GGGCCGAGGGGGACACCGGGTGG - Intronic
1143323237 17:6081266-6081288 GAGCCATGTGGAACTCCAGCTGG - Intronic
1145218898 17:21072748-21072770 GGGCTGAGTGGGACAGGAGCTGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1148823228 17:50373070-50373092 AGGCAGAGTGGAGCTCCAGCAGG - Intronic
1150321595 17:64218764-64218786 GGCCAGCGTGGAACACCAACTGG + Intronic
1156588445 18:38459168-38459190 GGGCTTAATGAAACACCAGCTGG + Intergenic
1160790486 19:920643-920665 GGGCCGGGTGGGACCCCAGGCGG - Exonic
1163211937 19:15847286-15847308 CAGCCCAGTGGAACACCTGCCGG - Intergenic
1165382386 19:35490382-35490404 GGGCAGAGTGGAGCACCAGGAGG + Exonic
925704493 2:6670931-6670953 GGGTCAAGGGAAACACCAGCTGG - Intergenic
929629948 2:43449318-43449340 GGGACCTGTGGAACACCATCAGG + Intronic
930116222 2:47720599-47720621 GGGCCAAGTGGATCCCCAGAAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946509154 2:220335444-220335466 GGACCTAATGAAACACCAGCTGG - Intergenic
946593137 2:221273787-221273809 GAGGTGAGTGGAAAACCAGCTGG + Intergenic
1169331934 20:4722996-4723018 GGGCCTGGGGGAACACCAGGAGG - Intronic
1170026866 20:11898229-11898251 GTGCCGAGTGGGAGACAAGCGGG - Intronic
1171935817 20:31274187-31274209 GGGCAGAGAGGAGCAGCAGCAGG - Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1176871317 21:14084888-14084910 GGGCGGAGTGGCCCGCCAGCTGG + Intergenic
1181047738 22:20223616-20223638 TGGTCAAGTGGAACCCCAGCAGG + Intergenic
1183961841 22:41415926-41415948 GGGCTGAGTGGCTCACCAGGTGG - Intergenic
949829341 3:8197333-8197355 TGACCTAGTGAAACACCAGCTGG - Intergenic
951437060 3:22676887-22676909 TGGCCTAGTGAGACACCAGCTGG - Intergenic
953154498 3:40356810-40356832 GGCCAGAGGGGAGCACCAGCTGG + Intergenic
954112261 3:48440637-48440659 GGGCCGAATGGAGCTCAAGCTGG + Intronic
958912221 3:100006673-100006695 GGGCTGAGTGCAACCCAAGCTGG - Intronic
962078780 3:132114890-132114912 TGACCTAGTGAAACACCAGCTGG - Intronic
963995898 3:151708675-151708697 TGACCCAGTGAAACACCAGCTGG + Intergenic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
968706987 4:2083727-2083749 GGGACCACAGGAACACCAGCAGG + Intronic
971146152 4:23978761-23978783 GGGGAGAGTGAAACACCTGCAGG + Intergenic
972635038 4:40876811-40876833 GGGCCGACTGTATCAACAGCTGG + Intronic
980982107 4:139663507-139663529 GGGAAGAGAGGAACAACAGCAGG - Intergenic
983318149 4:166158734-166158756 GAGCAGAGTGTAACAGCAGCAGG + Intergenic
985665358 5:1179302-1179324 GGGCTGCGTGGGACTCCAGCGGG - Intergenic
992532554 5:77666216-77666238 GGGCCGTGTGGAAAAGCACCAGG - Intergenic
996404764 5:123094272-123094294 GAGCCCAGTGGCACACCAGCAGG + Intronic
996653670 5:125913688-125913710 TGGCCCAGTGAGACACCAGCTGG - Intergenic
997402311 5:133612337-133612359 GGGCCGAGGGGAAGACCAGGTGG + Exonic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1002373920 5:178775062-178775084 GGGACGCATGGCACACCAGCCGG + Intergenic
1014799176 6:125759008-125759030 GGACAGAGTGGAACATCAGTGGG + Intronic
1015244576 6:131062719-131062741 GGGCCCCGTGGAGCAACAGCGGG - Intronic
1017242247 6:152183388-152183410 GGGCAGAGTTCAAGACCAGCCGG + Intronic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1019702289 7:2479884-2479906 GGGCCGAGGGGAGCACCAGACGG - Intergenic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1022189365 7:28002223-28002245 AGGCCCAGTGGAATTCCAGCAGG + Intronic
1026962478 7:74417564-74417586 GGGCCGAGGGTGACACCTGCTGG - Intergenic
1029538703 7:101170670-101170692 GGGCAGAGGTGGACACCAGCAGG - Exonic
1032383636 7:131506854-131506876 GGCCTGCGTGGAGCACCAGCTGG - Intronic
1033783911 7:144706865-144706887 GGGCCCAATGGAAGACTAGCTGG + Intronic
1034468396 7:151243166-151243188 GGGCCCAGGGGAAGCCCAGCAGG - Intronic
1035415164 7:158677345-158677367 GGGCAGAGTGCAACAGCAGGAGG - Intronic
1038490406 8:27966483-27966505 GGGCCGACAGGGACCCCAGCTGG + Exonic
1041255391 8:55976119-55976141 GGGCAGAGTTTATCACCAGCTGG + Intronic
1046395534 8:113633852-113633874 TGGCCGAGTGGCCCACCAGAAGG - Intergenic
1049695701 8:143983446-143983468 AGGCCGAGTGCACCACCAGCTGG + Exonic
1052362061 9:27572684-27572706 TGGCCGCGTTGAACACCACCAGG - Intronic
1053056548 9:34996391-34996413 GGGCCGAGTGGAGCGGCTGCTGG - Exonic
1057115066 9:92513190-92513212 GCTCTGAGTGGAACAACAGCAGG - Intronic
1060971324 9:127739814-127739836 GGGCCGAGTCACACTCCAGCAGG + Exonic
1060996295 9:127876416-127876438 GGGCCGAGTTGGACCCTAGCTGG - Intronic
1186797148 X:13057944-13057966 GGAACTAGAGGAACACCAGCAGG + Intergenic
1190119732 X:47650310-47650332 GCGGGGAGTCGAACACCAGCAGG + Intronic
1190713374 X:53084955-53084977 GGGTTGAGTGAGACACCAGCCGG - Exonic
1193658298 X:84224955-84224977 GGACCTAGTGAGACACCAGCTGG - Intergenic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic