ID: 1019442543

View in Genome Browser
Species Human (GRCh38)
Location 7:1054744-1054766
Sequence AGCTGAGCCGGCCCCACACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019442543_1019442547 13 Left 1019442543 7:1054744-1054766 CCGTGTGTGGGGCCGGCTCAGCT 0: 1
1: 0
2: 1
3: 6
4: 138
Right 1019442547 7:1054780-1054802 GCCCATGTCCCTTCTGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019442543 Original CRISPR AGCTGAGCCGGCCCCACACA CGG (reversed) Intronic
900712980 1:4126797-4126819 GGCTAAGCCTGCCTCACACACGG + Intergenic
900779959 1:4611669-4611691 GGCTGAGGCAGCCCCACACTCGG + Intergenic
903661025 1:24978708-24978730 AGCTCTGGAGGCCCCACACACGG - Intergenic
903726150 1:25446927-25446949 AGCTGAATGGTCCCCACACATGG - Intronic
912697481 1:111852334-111852356 TGCTGAGCAGGCCCCACAGAGGG - Intronic
914995611 1:152541023-152541045 TGCAGAGCCTGCCACACACAGGG + Intronic
917132340 1:171755565-171755587 GCCTGGGCCGGCCCCACAGATGG + Intergenic
919807088 1:201386511-201386533 TGCTAAGCCGGCCCCAAAGAGGG - Exonic
922445430 1:225692972-225692994 TGGTGAGCCGGCCCCACTAATGG + Intergenic
924697289 1:246413677-246413699 AGCGGAGCTGGCCCGTCACATGG - Intronic
1070804792 10:79264716-79264738 ATGTGAGCCAGCCCCTCACAAGG + Intronic
1070833986 10:79436577-79436599 AGGTGAGGAGGCCTCACACACGG - Intronic
1071257961 10:83890867-83890889 AGCTGAGCTGCCCACACACAGGG - Intergenic
1075654576 10:124152635-124152657 AGCTGTGCTGGCCCCACTCCAGG - Intergenic
1075880189 10:125844426-125844448 AGTTGAGTTGGCCGCACACAGGG + Intronic
1076714057 10:132354437-132354459 AGCGGGGCCAGCACCACACATGG + Intronic
1077234454 11:1473133-1473155 GGCTGAGTCAGCCCCGCACAGGG - Intronic
1078072573 11:8126671-8126693 AGCTGAGGAGGCCCCTTACATGG - Exonic
1078174945 11:8963735-8963757 AGCTGAGTCGGCCCTTGACAGGG + Intronic
1078550010 11:12273752-12273774 AGCTGAGACGGCCAGCCACAGGG + Intergenic
1084128592 11:67117917-67117939 AGCTGCGCCGGCCCTGCCCACGG - Intergenic
1084840685 11:71843906-71843928 GGCTCAGCAGGCCCCACACTTGG - Intergenic
1084980936 11:72828383-72828405 AGGTGACCCGGCCCTGCACAGGG - Exonic
1085520945 11:77138494-77138516 AGCTGGGCGGGCCACAAACAGGG + Intronic
1091772159 12:3159289-3159311 AACTGAGACGGACCCAGACAAGG - Intronic
1098962478 12:76753434-76753456 AGCTGAGATGGCACCACAGAGGG - Intergenic
1103659250 12:122500589-122500611 CGCTGCCCCGGCCCCACACCCGG + Exonic
1103927261 12:124429828-124429850 AGAGGGGCCGGCCCCACACCCGG + Intronic
1106455431 13:29922786-29922808 AGCTCAGCCCTCCCCACTCATGG - Intergenic
1108995994 13:56735678-56735700 AGCTGGGCGGGCCCCGCACTGGG + Intergenic
1112933212 13:104767554-104767576 AACTGAGCTGGCCTCAGACAGGG - Intergenic
1113330201 13:109319347-109319369 GGCTCAGCAGGCCCCACACTCGG - Intergenic
1113542041 13:111116005-111116027 AGCGGGGCCGGCCCCCCACGCGG - Intronic
1116402773 14:44529091-44529113 AGCTGAGCATGCCCAACATAAGG - Intergenic
1118503863 14:66389638-66389660 ATCTCAGCCAGCCCCACCCATGG - Intergenic
1118839472 14:69500207-69500229 AGGTGAGGCGGCCCCTCCCAGGG + Exonic
1119749634 14:77068196-77068218 AGCAGACCCGGCCCCACTCTGGG + Intergenic
1122797365 14:104212698-104212720 AGCTGCGCCGTCCCCACCCCGGG - Intergenic
1122919415 14:104873918-104873940 ACCTCAGCCCGCCCGACACATGG - Intronic
1123053879 14:105560241-105560263 AGCAGACCCGGCCCCACAGGAGG - Intergenic
1123078462 14:105680658-105680680 AGCAGACCCGGCCCCACAGGAGG - Intergenic
1128260932 15:66232355-66232377 AGCTGGACCGGCCCCAGTCAAGG + Intronic
1128520549 15:68372048-68372070 AGCTGACCCAGCCCCACAGTTGG + Intronic
1133851658 16:9510142-9510164 AGCTGAGCTGGCCCCAGATCAGG + Intergenic
1136428926 16:30186032-30186054 AGCTGGGCCCGCGCCCCACATGG + Intronic
1136454809 16:30374462-30374484 ATCTGAGCCCACCCCACTCAGGG + Intronic
1136553824 16:30996655-30996677 AGCAGAGCCCGCCCCACCCGCGG + Intronic
1140660879 16:77190647-77190669 ACCTGTGCCGGACCCACAAACGG - Intergenic
1141054087 16:80800617-80800639 AACTGAGCCACCCCTACACACGG + Intronic
1142147703 16:88499464-88499486 AGCTGGGCCGGCCCCACCCCAGG - Intronic
1143688039 17:8535010-8535032 AGCTCAGCAGGCCTGACACAGGG + Intronic
1144068353 17:11644347-11644369 AGCTGAGCCAGTCACACACAAGG - Intronic
1144547854 17:16214999-16215021 ACCTGCGCCGGCCCCACCCGGGG + Intronic
1144849107 17:18235168-18235190 AGCTGTGCCTGCCCCATACCTGG + Exonic
1144961512 17:19046809-19046831 TGCTGAGTTGGCCCCACACGGGG - Intronic
1144973648 17:19127715-19127737 TGCTGAGTTGGCCCCACACGGGG + Intronic
1146757831 17:35448812-35448834 ACCTGGGCAGGTCCCACACAGGG + Exonic
1147987622 17:44315431-44315453 GGCTGAGCCGGCGCCCCGCAGGG + Exonic
1150280840 17:63928948-63928970 AGGTGATCCGTCCCCACACATGG - Exonic
1152803693 17:82344534-82344556 AGCTCAGCCTGGCCCACACCAGG + Intergenic
1153658324 18:7304946-7304968 AGGGGAGCAGGCCCCACACCAGG + Intergenic
1154411412 18:14144090-14144112 AGCTGTGGCGGGACCACACAAGG - Intergenic
1160764420 19:801043-801065 AGCTGACCTGGGCCCACACCTGG + Intronic
1161069545 19:2253297-2253319 AGCTGAGCGGTCCCCAGAGAGGG + Intronic
1161951237 19:7469269-7469291 GGCTGAGGCCACCCCACACAGGG + Intronic
1163639996 19:18456750-18456772 AGCTGAGCTGGCACCACATGTGG - Intronic
1167238907 19:48331628-48331650 GGCTGACCCAGCCCCACACCAGG + Intergenic
926087273 2:10028365-10028387 GGCTGAGCAGGCACCACACTGGG - Intergenic
926320771 2:11746937-11746959 AGCCAAGCCGGGCCCACACCGGG - Intronic
927156451 2:20224165-20224187 AGCTGAGCCGGCCCGGCAGCGGG - Intronic
927187998 2:20496356-20496378 AGCTCAGCCACCCCCACACCTGG - Intergenic
927357061 2:22186413-22186435 GGCTGGGCAGGCCCCGCACAGGG + Intergenic
928723136 2:34142817-34142839 GGCTCAGCGGGCCCCACACTTGG - Intergenic
931118991 2:59195835-59195857 AGCTTAGCAGTCCTCACACAGGG + Intergenic
934112552 2:88756794-88756816 GGCTGCTCAGGCCCCACACAGGG - Intergenic
1168779028 20:473150-473172 AGCTGAGCAGGGAGCACACATGG - Intergenic
1170916855 20:20634857-20634879 AGCACAACAGGCCCCACACAAGG + Intronic
1174180340 20:48670420-48670442 ATCTGTGCCCGCCCCACACCTGG + Intronic
1174962878 20:55177703-55177725 AGCTGAGTCCGGCCCACAGACGG - Intergenic
1175551070 20:59818094-59818116 AGCTGAGAGGGCCGCACACAAGG - Intronic
1176150682 20:63589206-63589228 CCCTGAGCCGGCCCCTCCCAGGG - Exonic
1176242514 20:64081592-64081614 AGCTCACCTGGCCCCACCCATGG - Intronic
1176295595 21:5070452-5070474 AGCTGAGCCTGGCCCACATTGGG - Intergenic
1179861454 21:44191672-44191694 AGCTGAGCCTGGCCCACATTGGG + Intergenic
1179988478 21:44933630-44933652 AGCTGATCCGCCCCGACCCAGGG + Intronic
1180013931 21:45070647-45070669 AGCTGGGCAGGTCTCACACATGG + Intergenic
1183286362 22:36966879-36966901 AGCTGAGCCGCCCCCATGTAAGG - Intergenic
1183385992 22:37514957-37514979 AGGTGAGACTTCCCCACACAGGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
949841717 3:8327258-8327280 GGCTGGGCTGGCCCCACAAAGGG + Intergenic
954369022 3:50160663-50160685 GGCTGAGTCGACCCCACCCAGGG - Intronic
960996474 3:123343703-123343725 AGCTGTGCCCTCCCCACACCTGG - Intronic
961540277 3:127594763-127594785 AGCTGAGCTGGCTCAATACATGG + Intronic
964982525 3:162703214-162703236 GGCTCAGCGGGCCCCACACTCGG - Intergenic
966936902 3:184716724-184716746 AGCTGATCTGGCTCCAAACAGGG + Intergenic
969224110 4:5783486-5783508 AGCAGCTCAGGCCCCACACAGGG + Intronic
969418749 4:7077542-7077564 GGCTGGGCTGGCCCCACACCTGG + Intergenic
969781782 4:9409899-9409921 GGCTCAGCGGGCCCCACACTTGG - Intergenic
971043370 4:22778885-22778907 GGCTCAGCAGGCCCCACACTCGG - Intergenic
971281701 4:25246905-25246927 GGCTGGGCAGGCCCCACACTGGG - Intronic
982770124 4:159390029-159390051 GGCTCAGCGGGCCCCACACTCGG + Intergenic
985729778 5:1540696-1540718 GGCTGAGGAGGCCTCACACACGG - Intergenic
986344549 5:6822725-6822747 AGCTGAGCCAGCCACACTGAGGG - Intergenic
986616081 5:9618773-9618795 AGCTGAGCCGACCCGAGACCAGG - Intergenic
988035598 5:25823608-25823630 GGCTCAGCGGGCCCCACACTCGG - Intergenic
997476239 5:134144214-134144236 AGCCGTGCTGTCCCCACACAGGG + Intronic
999244556 5:150147103-150147125 GGCAGAGCCGGCCACACACCTGG - Intronic
1001585141 5:172828924-172828946 AGATGAACCGGCCGCACCCATGG + Intergenic
1002453015 5:179330418-179330440 AGCTGAGACTGCCCCAATCAGGG + Intronic
1003503485 6:6721897-6721919 AGCTGAGGGGGCCCCAAACTGGG - Intergenic
1010270352 6:73910059-73910081 GGCTCAGCGGGCCCCACACTGGG + Intergenic
1017872973 6:158502359-158502381 AGGTGTGCCGGCCCCGCACCCGG + Exonic
1018828891 6:167426952-167426974 AGCTGAGTCAGCCCCATAGAAGG - Intergenic
1019065424 6:169292151-169292173 TGCTGTCCCGGCCTCACACAAGG - Intergenic
1019307952 7:344745-344767 AGCTCAGCTGGCCCCAGGCAGGG + Intergenic
1019442543 7:1054744-1054766 AGCTGAGCCGGCCCCACACACGG - Intronic
1021649908 7:22822850-22822872 AGGTGCGCAGGCGCCACACACGG + Exonic
1021665673 7:22976061-22976083 AGCTCAGCCTACCCAACACATGG - Intronic
1021952699 7:25790691-25790713 AGCTCAGCATGCCCCACACCAGG - Intergenic
1024062776 7:45711063-45711085 AGCTGAGGTGGCCTGACACATGG + Intronic
1024248142 7:47485775-47485797 TGCTGTGCCTGCCCCACACCTGG + Intronic
1025814975 7:64903042-64903064 AACTGAGCCCGGCCCACCCACGG - Intronic
1029652191 7:101901189-101901211 AGCTGGGCCCGCCCTACCCAGGG - Intronic
1032782978 7:135178977-135178999 AGCTGTGTGGGCCCCAGACAAGG + Intergenic
1034346211 7:150386842-150386864 AGCAGAGCCGGGCACACAGAGGG - Intronic
1035259609 7:157653098-157653120 TGCTGAGCCTGCCCCCCAGACGG + Intronic
1037765065 8:21767646-21767668 GGCAGAGCCTGCCTCACACACGG + Intronic
1040003715 8:42600351-42600373 GGCTCAGCGGGCCCCACACTTGG - Intergenic
1044776393 8:95693444-95693466 CGCTGACCCGGCCCCAGTCAGGG - Intergenic
1046497753 8:115036779-115036801 GGCTTGGCCGGCCCCACACTGGG + Intergenic
1048484328 8:134832622-134832644 AGCCGAGCCCGCCCCGCCCACGG - Intergenic
1049470417 8:142772849-142772871 ACCTGTCCCAGCCCCACACATGG - Intronic
1049753817 8:144298922-144298944 AGATGAGCAGGACTCACACAGGG + Intronic
1049760765 8:144331105-144331127 AGCTGTGCAGGCACCACACCTGG + Exonic
1050294889 9:4195368-4195390 GGCTTGGCCGGCCCCACACTCGG + Intronic
1050459304 9:5863549-5863571 ACCTGTGCCAGCCCCAAACAAGG - Intergenic
1058727502 9:107817864-107817886 GGCTCAGCGGGCCCCACACTGGG + Intergenic
1061007390 9:127935852-127935874 AGCAGAGCCACCCACACACAGGG + Intronic
1062217273 9:135396041-135396063 GGCTGAGCCGACCCCAGACTCGG + Intergenic
1062389693 9:136329038-136329060 AGCTGTGCAGGCCTCACCCAAGG - Intronic
1186620830 X:11238402-11238424 ACCTGATCCTGCCCCACCCAAGG - Intronic
1187289744 X:17941687-17941709 AGCTGATCCTGCCCCACACATGG - Intergenic
1192848033 X:74925636-74925658 AGCAGAGGCGGCCCCACTCTGGG - Intergenic
1198390224 X:136166875-136166897 AGCAGTGCCTCCCCCACACAAGG - Intronic
1198390372 X:136168065-136168087 AGCAGGGCCTCCCCCACACAAGG - Intronic
1200231561 X:154446306-154446328 GGCTGGGCAGGCCCCACATAGGG + Intronic