ID: 1019443137

View in Genome Browser
Species Human (GRCh38)
Location 7:1057416-1057438
Sequence CCAGAAGTGCTGCAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019443137_1019443145 -9 Left 1019443137 7:1057416-1057438 CCCTGTACCTGCAGCACTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1019443145 7:1057430-1057452 CACTTCTGGGCCAGGGCTTTGGG 0: 1
1: 0
2: 2
3: 21
4: 247
1019443137_1019443147 -4 Left 1019443137 7:1057416-1057438 CCCTGTACCTGCAGCACTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1019443147 7:1057435-1057457 CTGGGCCAGGGCTTTGGGACGGG 0: 1
1: 0
2: 2
3: 52
4: 430
1019443137_1019443144 -10 Left 1019443137 7:1057416-1057438 CCCTGTACCTGCAGCACTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1019443144 7:1057429-1057451 GCACTTCTGGGCCAGGGCTTTGG 0: 1
1: 0
2: 1
3: 46
4: 252
1019443137_1019443146 -5 Left 1019443137 7:1057416-1057438 CCCTGTACCTGCAGCACTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1019443146 7:1057434-1057456 TCTGGGCCAGGGCTTTGGGACGG 0: 1
1: 0
2: 3
3: 48
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019443137 Original CRISPR CCAGAAGTGCTGCAGGTACA GGG (reversed) Intronic
900871557 1:5307774-5307796 CCCAAAGTGCTACAGTTACAGGG - Intergenic
904980427 1:34496562-34496584 CCCGAAGTGCTGGAATTACAGGG - Intergenic
906318471 1:44802791-44802813 CCAGAAGTGCTGCTGAGACAGGG + Exonic
912430647 1:109626799-109626821 GCAGAAGCTCTGCAGGGACAGGG - Exonic
912492589 1:110070385-110070407 CCCGAGGTCCTGCAGGTACTTGG + Exonic
916879844 1:169009911-169009933 TCATATGTGCTGCTGGTACATGG + Intergenic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
919255876 1:195124086-195124108 CTCGAAGTGTTGCAAGTACATGG + Intergenic
921105470 1:211972787-211972809 CCACAAGTTCTTCAGGTGCAAGG + Intronic
921268839 1:213449118-213449140 CCAGAATTTCTGCAGGGAAATGG + Intergenic
921528592 1:216250971-216250993 CCAGAGGTATTGCAGTTACAGGG + Exonic
923485816 1:234430079-234430101 CTTGGAGTGCAGCAGGTACAGGG - Exonic
1063112290 10:3047606-3047628 CTAGAAGAGCTGCAGGAATAAGG + Intergenic
1064974814 10:21102706-21102728 CCAGAATTCCAACAGGTACATGG - Intronic
1065511467 10:26482824-26482846 CCCAAAGTGCTGGAGTTACAGGG - Intronic
1068758178 10:60679154-60679176 CCAAAATTGCTGCATGGACAGGG + Intronic
1070445094 10:76491544-76491566 CCAGATGTGTTGCAGATCCATGG + Intronic
1073439302 10:103543327-103543349 CCAATAGTACTGCAGGAACAAGG + Intronic
1074423707 10:113331970-113331992 CTACGAGTGCTGCAGGGACAAGG + Intergenic
1075087781 10:119424863-119424885 CCAGACGTGCTGCATCTGCATGG + Intronic
1075282950 10:121156365-121156387 CCAGAAGTGCTGAAGGTTTAGGG + Intergenic
1076785685 10:132748826-132748848 GCAGCAGTGCTGCAGGGTCAGGG - Intronic
1077063699 11:628535-628557 CCAGCAGCGCAGCAGGGACACGG + Intergenic
1078280264 11:9894120-9894142 CCCAAAGTGCTGCAATTACAGGG - Intronic
1078825917 11:14930239-14930261 CCAGAAGTCCTGCAGAAACAAGG - Intronic
1079167135 11:18055292-18055314 CCAGAAGTGCTGGTATTACAGGG - Intergenic
1079409621 11:20175020-20175042 CCAGAATTGCTCCAAGTGCAGGG - Intergenic
1083094090 11:60232420-60232442 CCAGAATGGCTGCAGGAAGAAGG + Intronic
1083722815 11:64611805-64611827 CCAGAGGAGCTGCAGATGCAGGG - Intronic
1084031929 11:66486399-66486421 CTACAAGTGCTGCTGGTCCATGG + Intronic
1084368136 11:68717059-68717081 CCCATAGTGCTGCAGGAACACGG + Intronic
1084470602 11:69356961-69356983 AGAGAAGTGCTGCAGGCACTGGG - Intronic
1084752783 11:71215012-71215034 CTGGCTGTGCTGCAGGTACATGG + Intronic
1085444374 11:76590624-76590646 CCTGGAGGCCTGCAGGTACATGG + Intergenic
1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG + Intronic
1088469578 11:110178201-110178223 CCAGGAGAGCTGCAGGTGGAGGG - Intronic
1089192010 11:116660195-116660217 CCAGAAAGGCTGCAGGGACATGG + Intergenic
1091366898 11:135029868-135029890 AGAGAAGTGCTGCAGGCCCAGGG + Intergenic
1091497980 12:989228-989250 CCAGAAGTGCTTTAGGGAGACGG - Intronic
1093592595 12:20921625-20921647 TCTGAAATGCTGCAAGTACATGG - Intergenic
1096452768 12:51758081-51758103 GCCGAAGTGCTCCAGGAACACGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101352570 12:103945681-103945703 TCAGCAGTGCTCCAGGTACTTGG + Intronic
1103681570 12:122698450-122698472 CCAAAAGTGCTGAGGTTACAGGG + Intergenic
1104200809 12:126586827-126586849 GCAGAAGTGGTCCAGGTTCATGG + Intergenic
1105731335 13:23220098-23220120 CCCAAAGTGCTGCAATTACAGGG + Intronic
1106079352 13:26487745-26487767 CCAGAGGTCCTGCAGGTGGAGGG - Intergenic
1107035105 13:35894161-35894183 CCAGAAGTATTTCAGATACAAGG - Intronic
1107363897 13:39649282-39649304 CCCAAAGTGCTGGAGTTACAAGG + Intergenic
1113876515 13:113597990-113598012 CCAGGAGGGCTGCAGGCACGAGG + Intronic
1116258419 14:42587994-42588016 CCAGAAGAGCAGCAGGCACCAGG - Intergenic
1120027549 14:79603381-79603403 CCAGAAGATATGCAGGGACAGGG - Intronic
1121587685 14:95074266-95074288 CCAGGAGTTCTGCATCTACAAGG + Intergenic
1121832966 14:97067676-97067698 CCCAAAGTGCTGGAGTTACAAGG + Intergenic
1122308998 14:100783033-100783055 CCAGAGGGGCTGCAGGCACCAGG + Intergenic
1122440525 14:101728637-101728659 CCCAAAGTGCTGCAATTACAGGG - Intergenic
1124545361 15:30621467-30621489 CCAGCAGGGATGCAGGTAAAAGG + Intergenic
1129317962 15:74757467-74757489 CCCGAAGTGCTGGAATTACAGGG - Intergenic
1129828571 15:78651895-78651917 CCAAAAGGGCTGCAGGGACAGGG + Intronic
1132085010 15:98901283-98901305 CCAGTAGTCCTGCAGCTCCAAGG + Intronic
1132379448 15:101356398-101356420 CCGAAAGTGCTGCAATTACAGGG - Intronic
1134140292 16:11712691-11712713 CCAGAAGTGCTGTGGTTAAAGGG - Intronic
1134551450 16:15140810-15140832 CCAGTAGTGCTCCTGGCACAGGG + Intergenic
1137236727 16:46623806-46623828 ACAGAGGTGCTCCAGGGACAGGG + Intergenic
1139515929 16:67452373-67452395 CAAGAAGTGCTGCAGCCAAAGGG - Intronic
1139744772 16:69065422-69065444 CCAAAAATGCTACAGGGACATGG - Intronic
1141168331 16:81675476-81675498 CCAGAAGTGCTGGGATTACAGGG + Intronic
1142608528 17:1095588-1095610 CCAGTCCTGCTGCAGGGACAAGG + Intronic
1143618021 17:8064922-8064944 CCAGCAGTCCTGCAGTTTCAGGG - Intergenic
1144690204 17:17256848-17256870 CCCAAAGTGCTGGAAGTACAGGG + Intronic
1145976107 17:28985361-28985383 TCAGATGTGCTTCAGGCACAGGG - Intronic
1146054865 17:29575955-29575977 CCAGCAGTGCAGCAGGGACCAGG + Intronic
1146295207 17:31644492-31644514 CCCAAAGTGCTGCAGTTATAGGG - Intergenic
1146841821 17:36161686-36161708 CCTGAAGTGGTGCAGGTGCCTGG - Intergenic
1146854130 17:36249646-36249668 CCTGAAGTGGTGCAGGTGCCTGG - Intronic
1146870034 17:36373538-36373560 CCTGAAGTGGTGCAGGTGCCTGG - Intronic
1146877391 17:36424619-36424641 CCTGAAGTGGTGCAGGTGCCTGG - Intronic
1147072915 17:37974162-37974184 CCTGAAGTGGTGCAGGTGCCTGG - Intergenic
1147084437 17:38053700-38053722 CCTGAAGTGGTGCAGGTGCCTGG - Intronic
1147100384 17:38177666-38177688 CCTGAAGTGGTGCAGGTGCCTGG - Intergenic
1150083326 17:62260713-62260735 CCTGAAGTGGTGCAGGTGCCTGG - Intergenic
1150620765 17:66806418-66806440 CCTGCAGGGCTGCAGGGACAGGG - Exonic
1151991418 17:77577410-77577432 ACAGAAATGCTGCAGGCAAAAGG + Intergenic
1152126653 17:78451125-78451147 CCAGAAATGTGGCAGGTGCAAGG + Intronic
1152484019 17:80577775-80577797 CCAGGAAGGCTGCAGGTCCAAGG - Intronic
1153841344 18:9010903-9010925 CCAGGAGTTCTGGAAGTACAAGG - Intergenic
1155001355 18:21690340-21690362 CCCGAAGTGCTGTAATTACAGGG - Intronic
1160916210 19:1497851-1497873 CCAGTAGTGCTGCAGGCACGGGG - Exonic
1163354330 19:16800041-16800063 CCAGAAATGGTGCAGGCACCCGG - Exonic
1163367061 19:16881155-16881177 TCAGAAGTGCTGCAGGGGCTGGG + Intergenic
1164828022 19:31298565-31298587 ACAGTACTGCTGCAGGTAGATGG - Intronic
1166226548 19:41399264-41399286 ACAGAAGGGCTGCAGGAGCAAGG + Intronic
1167305250 19:48704498-48704520 CCAGAAGTGGCCCAGGTCCAGGG + Exonic
925298462 2:2793369-2793391 CCAGGAGGGCAGCAGGAACACGG - Intergenic
926686286 2:15700504-15700526 CCAGAAGTGGGGCAGTTCCAGGG - Exonic
929453030 2:42048824-42048846 CCCAACGTGCTGCAGGTACGAGG + Exonic
931083156 2:58798561-58798583 CCAGAAGTGGTGCTGTGACAGGG - Intergenic
932028267 2:68157383-68157405 CCAGAAGGGCTTCAACTACACGG - Exonic
933053057 2:77624965-77624987 CCCAAAGTGCTGCAATTACAGGG + Intergenic
934153095 2:89168504-89168526 CCCACAGTGCTGCAGGTGCAGGG - Intergenic
934214145 2:90013427-90013449 CCCACAGTGCTGCAGGTGCAGGG + Intergenic
937966119 2:127512574-127512596 CTAGAAGAGCAACAGGTACAGGG - Intronic
941656706 2:168152098-168152120 CCAGATGTGCTGAAGGTTCCAGG + Intronic
944786491 2:203076221-203076243 CCCGAAGTGCTGGGAGTACAAGG - Intronic
945408468 2:209480775-209480797 CCAGAAGTCCTGTTGGTATAGGG + Intronic
946705512 2:222454985-222455007 CCAGGAATTCTGCAGGAACAAGG + Intronic
948168279 2:235879665-235879687 CCAGAAGTGCTGGGGTAACAGGG - Intronic
948766969 2:240227369-240227391 CCAGCTGTGCTGCAGGTCCCTGG + Intergenic
1169634424 20:7672392-7672414 CCCAAAGTGCTGGAGTTACAGGG + Intergenic
1171880298 20:30613718-30613740 CCAGGAGTGCTGCTAGAACATGG - Intergenic
1172599397 20:36173525-36173547 CCTGAAGAGCTGCAGACACAGGG + Intronic
1174293514 20:49526441-49526463 TCAGAACTGCTGTAGGCACAGGG - Intronic
1174773192 20:53320580-53320602 CTAGAAGTGTTGCTGGTAGAAGG + Intronic
1175665505 20:60855307-60855329 CCAGAAGTGGTAAAAGTACAAGG - Intergenic
1176216664 20:63951349-63951371 CCAGGAGGGGTGCAGGCACACGG - Intronic
1177604469 21:23360113-23360135 AGAGATTTGCTGCAGGTACAGGG - Intergenic
1178548353 21:33513222-33513244 CCCGAAGTGCTGGAATTACAGGG + Intronic
1179319525 21:40276663-40276685 CAAGGAGTGCTCCAGGGACATGG + Intronic
1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG + Intronic
1179434761 21:41352533-41352555 CCCAAAGTGCTGCAATTACAGGG - Intronic
1181035140 22:20166328-20166350 CCAGAACATCTGCAGGCACAGGG - Intergenic
1181508668 22:23379018-23379040 CCAGAACACCTGCAGGCACAGGG + Intergenic
1181581286 22:23829434-23829456 CCAGCAGTCCTACACGTACAGGG + Intronic
1183050930 22:35260413-35260435 CCAAAAGGGGTGCAGGTAGAAGG - Intronic
1183963696 22:41428480-41428502 CAAGAAGAGGTGCAGGCACAGGG + Intergenic
1184962835 22:47944011-47944033 CTAGAATTGCACCAGGTACATGG - Intergenic
949904926 3:8851482-8851504 CCATACGTGCTGTTGGTACAGGG - Intronic
950536657 3:13582803-13582825 CCAGAGGTTCTGCAGGAACTGGG + Intronic
953785651 3:45909277-45909299 CCACCAATGCTGCAGGTCCATGG + Intronic
954363392 3:50134104-50134126 CCAGAAGGGCTGTAGCTATAGGG - Intergenic
957046348 3:75378115-75378137 CTAGTAGTGCTGGAGGTAGAGGG - Intergenic
957835549 3:85584325-85584347 CCAGAAGTGATTAAGGTAGAGGG - Intronic
960802283 3:121551764-121551786 CCCGAAGTGCTGGGGTTACAGGG - Intergenic
961351052 3:126303289-126303311 CCAGAAGTCCTTCAGGCAGAAGG - Intergenic
961477911 3:127160040-127160062 CCAGAGGTGCTGTATGCACAAGG - Intergenic
961655344 3:128438734-128438756 CCTGCAGTGCTCCAGGCACACGG - Intergenic
961749847 3:129088504-129088526 ACAGAGGTGCTCCAGGGACAGGG + Exonic
962241176 3:133752355-133752377 CCCAAAGTGCTGGAAGTACAAGG + Intronic
963537235 3:146544235-146544257 CTGGAAGTGGAGCAGGTACACGG - Intronic
963770501 3:149381678-149381700 CCAGACATGCTCCAGGTACTGGG - Intergenic
964315891 3:155444030-155444052 ACAGAAGTGCTGGTGGTAAAGGG - Intronic
966016152 3:175140216-175140238 CCAGAACTGATTTAGGTACATGG - Intronic
966019513 3:175190626-175190648 CCAGAAGTGAGGCAGTTACCAGG + Intronic
966986483 3:185184622-185184644 CCAGAAGTGCTGCCAGAAGATGG - Intergenic
968123445 3:196142185-196142207 CCAGACCTGCTGCAGGGACGAGG - Intergenic
968123471 3:196142263-196142285 CCAGACCTGCTGCAGGGACGAGG - Intergenic
968757774 4:2425832-2425854 CCAGAGGTGCAGCAGTTCCAGGG - Intronic
969458974 4:7317583-7317605 CCAGAGGTGCCGCAGGCCCATGG - Intronic
970482421 4:16489955-16489977 CTACAACTGCTGTAGGTACAGGG - Intergenic
970660388 4:18278924-18278946 CCAGAAGTGTTGGAGGCAGAAGG - Intergenic
970723862 4:19019739-19019761 CCAGAAGTGCGGAAGGATCATGG - Intergenic
973901088 4:55472600-55472622 ACACTAGTGCTGCAGATACAAGG - Intronic
974225459 4:59037533-59037555 ACAGAATTGTTGCAGGTACCAGG - Intergenic
976466068 4:85370052-85370074 CCAGCAGTGCTACTGGGACATGG - Intergenic
979047897 4:115893432-115893454 CCCAAAGTGCTGGAAGTACAGGG - Intergenic
980400758 4:132281849-132281871 ACAGAAGGGCTGCTGGAACAGGG + Intergenic
984811246 4:183797870-183797892 CCAGAAGTGCTGCATGTTCTCGG - Intergenic
985082893 4:186284433-186284455 TCAGAACAGGTGCAGGTACAAGG + Intronic
985546413 5:511677-511699 CCAGCACTGCTGGAGGCACAGGG + Intronic
987947017 5:24623191-24623213 CCAGCAGTCCTGCAGATGCAGGG + Intronic
990514795 5:56521112-56521134 CCAGGAGCTCTGCAGGGACATGG + Intronic
991135749 5:63180097-63180119 CCCAAAGTGCTGGAGTTACAGGG - Intergenic
994814199 5:104563482-104563504 CCAGAAATCCTCCAGGTATAGGG + Intergenic
996334527 5:122368355-122368377 CGAAAAGTTCTGCAAGTACAAGG - Intronic
997513000 5:134466077-134466099 CCAGAACTGCTGGAGGAACTTGG - Intergenic
997660350 5:135584418-135584440 ACAGCAGTGCTGCAGGATCACGG + Intergenic
997811543 5:136975115-136975137 CCAGGGGTGCTGCAGGTGCCAGG + Intergenic
1001145498 5:169180520-169180542 CCAGAAGGACTGCTGGTCCACGG + Intronic
1001862406 5:175068952-175068974 CAAGAAATGCTGCAGATGCATGG - Intergenic
1001873701 5:175180995-175181017 TCAGACGTGCTCCAGATACATGG + Intergenic
1001942282 5:175749276-175749298 CAAGAAGTTCTCCAGGAACATGG - Intergenic
1002109286 5:176897439-176897461 CCAGAAGTTCTGCTGTTGCAAGG - Intronic
1003148467 6:3528719-3528741 TCAGAAGGGCTGCAGCTCCATGG + Intergenic
1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG + Intronic
1007401374 6:41604415-41604437 CCAGGAGTGGGCCAGGTACAGGG + Intergenic
1009436749 6:63627465-63627487 CCTAAAGTGCTGCAATTACATGG - Intergenic
1011017394 6:82772071-82772093 CCAGTATTGCTTCAGGCACATGG - Intergenic
1011583447 6:88898122-88898144 CCAGAAGTGAGGGTGGTACAGGG + Intronic
1011615886 6:89198208-89198230 CCAGTAGTGCCTCAGGTAGAGGG + Exonic
1011624049 6:89269199-89269221 CCAGTAATGCCGCAGGTACAGGG + Exonic
1018763117 6:166907798-166907820 CCAGAGGTTCCGCAGGTGCACGG - Intronic
1018800410 6:167217842-167217864 GTAGAAGTGCTGGAGGGACAGGG - Intergenic
1018809745 6:167289503-167289525 GTAGAAGTGCTGGAGGGACAGGG + Intronic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1019459479 7:1149324-1149346 CCAGAGGTGCTGCAGACGCAGGG + Intergenic
1019602937 7:1894352-1894374 CCAGAAGGTCTGCAGGGACCAGG + Intronic
1019850409 7:3550466-3550488 CCAGAAGAGCTGAAGGTAAAGGG - Intronic
1019866045 7:3711567-3711589 CCAGAGATGCTGCTGGTACCAGG + Intronic
1019985565 7:4652888-4652910 CCAAAAGTGCTGGAATTACAAGG + Intergenic
1020165865 7:5807396-5807418 CCCAAAGTGCTGGAGTTACAGGG + Intergenic
1021577999 7:22122365-22122387 CTCAAAGTGCTGCAGATACAGGG + Exonic
1023644158 7:42292082-42292104 CCACCAGTGATGCAGGCACAGGG - Intergenic
1024167058 7:46745889-46745911 CCAGAGGTGCTGTAGGATCAGGG - Intronic
1026064900 7:67062149-67062171 CCCGAAGTGCTGGAATTACAGGG - Intronic
1026319828 7:69258762-69258784 CCCAAAGTGCTGCAATTACAAGG + Intergenic
1026713406 7:72764538-72764560 CCCGAAGTGCTGGAATTACAGGG + Intronic
1029297181 7:99550813-99550835 CCCAAAGTGCTGCAATTACAGGG - Intronic
1029379618 7:100204633-100204655 ACAGAACTGCTGCAGGAGCATGG + Exonic
1029436800 7:100568256-100568278 CCCGGAGTGCAGCAGGGACAGGG + Intergenic
1031312911 7:120221177-120221199 CCAAAATTGCTGCAGCTACTGGG + Intergenic
1031687907 7:124754896-124754918 CCTGAAATGCTGCAAGGACAAGG - Intronic
1032395803 7:131588740-131588762 ACAGAAGTGAAGCAGGTGCAGGG - Intergenic
1032408517 7:131675269-131675291 CCAGCTCTGCTGCAGGTTCAGGG + Intergenic
1032825768 7:135566348-135566370 CCCGAAGTGCTGGGGTTACACGG + Intronic
1033344847 7:140518811-140518833 CCAGAAGTGGTGCGGGTAACGGG + Intronic
1034047086 7:147940795-147940817 CCAAAAGTGCTGGAATTACAAGG + Intronic
1034355903 7:150450720-150450742 TCAGAAGGGCTGCAAGAACAGGG - Exonic
1034415064 7:150959894-150959916 CCATAAGGGCGGCAGGCACATGG - Intronic
1035491307 7:159281322-159281344 CCAGAAATCCTGCTGGAACAGGG - Intergenic
1042069650 8:64917140-64917162 CCAGTAATGCTGCAAGCACATGG + Intergenic
1042574694 8:70205012-70205034 AAAGAAGTGCTGCAGGTCCAAGG + Intronic
1042859765 8:73300798-73300820 CCAGAAGTGCTGCAGTGGGAAGG - Intronic
1042874100 8:73424954-73424976 CCTGGAGTGCTGCAGGGAGAAGG + Intronic
1042952928 8:74220069-74220091 TCAGACGTGCTGCAGGAAGATGG + Intergenic
1043378857 8:79681514-79681536 CCAGATCTGGTGCAGGTACATGG - Intergenic
1048432574 8:134383921-134383943 CCAGAAGTGGTACAGGGTCATGG + Intergenic
1049197638 8:141324412-141324434 CCAGAAGCTGTGCAGGTCCAGGG + Intergenic
1049340827 8:142111821-142111843 CCAAAAGTGCTGCAGCATCAGGG - Intergenic
1049359133 8:142203635-142203657 CCAAAAGTGCTGCATTTACCAGG + Intergenic
1049705788 8:144041380-144041402 CCAGGGGTCCTGCAGGGACAGGG + Intronic
1049958065 9:711536-711558 GCGGATGTGCTGCAGGTGCATGG - Exonic
1054723252 9:68624439-68624461 CCAGAAGTGGAGCAGTCACACGG + Intergenic
1055664436 9:78539220-78539242 CCAGAAGGGTTGCAGAAACAGGG + Intergenic
1056711056 9:88991848-88991870 CCAGAGCCGCTGCAGGAACAGGG + Exonic
1057725084 9:97562718-97562740 CCAGGATCGCTGCAGGGACAAGG - Exonic
1060360731 9:122954201-122954223 CCAGAAGTGCAGCAAGTTCTGGG + Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1060968987 9:127727305-127727327 CCATGAGTGCTGCAGGGCCAAGG - Exonic
1060988960 9:127837449-127837471 CCAGAAAGGCTGGAGGTACCAGG - Intronic
1187796181 X:23006570-23006592 CGAGATGTGCTGCAGGGGCAGGG - Intergenic
1190768485 X:53495534-53495556 CCCAAAGTGCTGGAAGTACAGGG - Intergenic
1193117295 X:77787583-77787605 CCCAAAGTGCTGGAGTTACAGGG + Intergenic
1193288778 X:79746009-79746031 CCAGAAATGTTGCAGGGAAAGGG - Intergenic
1194115787 X:89895523-89895545 CCAAAAGTGCTGGAATTACATGG + Intergenic
1194697507 X:97072638-97072660 CCAGTACTGCTGTAGGTACCTGG + Intronic
1195262183 X:103143400-103143422 CCAAAAGTGCTGGGGTTACAGGG + Intergenic
1195410349 X:104563644-104563666 TCACAAGTGCTGCTGGTCCATGG + Intergenic
1196081497 X:111637645-111637667 CCAGAAGAGCTGTGGGTACAGGG + Intergenic
1197827105 X:130601445-130601467 CCAGAAGTCCTGCCTGTCCATGG + Intergenic
1200468584 Y:3552650-3552672 CCAAAAGTGCTGGAATTACATGG + Intergenic