ID: 1019446696

View in Genome Browser
Species Human (GRCh38)
Location 7:1074945-1074967
Sequence CACCACACGGGGCAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019446696_1019446709 30 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446709 7:1074998-1075020 TCCTTGTGACTGCAGATGTGTGG 0: 1
1: 0
2: 2
3: 28
4: 232
1019446696_1019446703 -1 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446703 7:1074967-1074989 GAGCGGGAGGACGTGTGAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 262
1019446696_1019446704 0 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446704 7:1074968-1074990 AGCGGGAGGACGTGTGAGCTGGG No data
1019446696_1019446705 1 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446705 7:1074969-1074991 GCGGGAGGACGTGTGAGCTGGGG No data
1019446696_1019446706 2 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446706 7:1074970-1074992 CGGGAGGACGTGTGAGCTGGGGG No data
1019446696_1019446707 3 Left 1019446696 7:1074945-1074967 CCTGGTGGCTGCCCCGTGTGGTG 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1019446707 7:1074971-1074993 GGGAGGACGTGTGAGCTGGGGGG 0: 1
1: 0
2: 3
3: 60
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019446696 Original CRISPR CACCACACGGGGCAGCCACC AGG (reversed) Intronic
902372660 1:16015888-16015910 CACCACCCTGGGCAGCCCCTCGG - Intronic
902623361 1:17663051-17663073 GACAAGACAGGGCAGCCACCGGG + Intronic
905915847 1:41683801-41683823 CACCACAGAGGGCTGCCTCCAGG - Intronic
912659053 1:111512592-111512614 CACCACCTTGGGCAGCTACCAGG + Intronic
913963206 1:143354600-143354622 CACCAGCCGGTGCAGCCAGCCGG - Intergenic
914057562 1:144180186-144180208 CACCAGCCGGTGCAGCCAGCCGG - Intergenic
914121584 1:144786180-144786202 CACCAGCCGGTGCAGCCAGCCGG + Intergenic
921871956 1:220150757-220150779 TCCCACACTGGGCTGCCACCTGG - Exonic
1062817123 10:508921-508943 CACCTCCAGGGTCAGCCACCTGG + Intronic
1063271087 10:4510414-4510436 CATCACGCTGGGCAGGCACCTGG + Intergenic
1065907606 10:30272151-30272173 CACAAAACTGGGCAGCCATCTGG + Intergenic
1067650094 10:48146803-48146825 GACCACATGGGGAAGACACCAGG + Intergenic
1070283017 10:75063581-75063603 CAACACACGGGCCAGCCTCCAGG - Intergenic
1075405488 10:122192881-122192903 CAGCACCCGGGGCAGCACCCAGG + Intronic
1076675298 10:132144417-132144439 CACCACCCGGGGCTTCCAGCGGG + Intronic
1081714973 11:45243577-45243599 CACCATGCAGGGCAGTCACCCGG - Exonic
1083477173 11:62922065-62922087 CCGCACATGGGGCAGGCACCTGG - Intergenic
1084700812 11:70785202-70785224 CACCACACAGGACAGACCCCTGG + Intronic
1084760526 11:71267901-71267923 CACCACCCAGGGCAGGCCCCTGG + Intergenic
1086851386 11:91813189-91813211 TACCTCACGGGGCAGCCATTAGG + Intergenic
1090825948 11:130386205-130386227 CAACACTCTGGGCAGCCAACGGG - Intergenic
1094524027 12:31219905-31219927 CTCCACACAGGGCAGGCTCCTGG - Intergenic
1096077554 12:48814805-48814827 CACCAGGCGGTGCCGCCACCTGG + Intronic
1100385547 12:94101997-94102019 CACCTCGCGGTGCAGCCCCCGGG + Intergenic
1100398758 12:94208772-94208794 CACCAGACGGGGCACCAACCTGG - Intronic
1104459673 12:128945174-128945196 CACCACACGCAGCAGCCGCGAGG + Intronic
1105723074 13:23135307-23135329 CACCTCAGGTGGCAGCCACAGGG - Intergenic
1106987513 13:35372667-35372689 CACCACACGAAGCTGCTACCTGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1113741720 13:112716098-112716120 CAGAAGACGGAGCAGCCACCGGG - Intronic
1114441181 14:22749377-22749399 CACCACTAGGGAAAGCCACCAGG - Intergenic
1114736705 14:25049946-25049968 CCCCGCGCGGGGCAGCCCCCCGG - Exonic
1116019369 14:39441992-39442014 CACTGCATGGGGCGGCCACCCGG - Intergenic
1121633675 14:95439503-95439525 CTCCACACTGGGCAGCACCCTGG + Intronic
1122295792 14:100705014-100705036 CACCACAGGGTGAAGCCACACGG + Intergenic
1122694520 14:103546285-103546307 CACCACACAGGGCAGCTGGCGGG - Intergenic
1122824691 14:104363956-104363978 CCCCACACGGAGCAGCCAGAGGG - Intergenic
1123183283 14:106489722-106489744 CACCACAGAGGGCAGCCAGCAGG + Intergenic
1128203961 15:65834077-65834099 CAGCACACAGGGCAGACACGGGG - Intronic
1129688344 15:77698921-77698943 CACTGCACGGGGCACCCACTAGG - Intronic
1130690387 15:86077220-86077242 AACCACACGGGGCAGGCAAGAGG - Intergenic
1132873547 16:2125938-2125960 CACCTCCCCGGGCAGCCAGCAGG + Intronic
1133232645 16:4373741-4373763 CACAACACTGGGCAGCCTCTGGG + Intronic
1133304332 16:4800312-4800334 CCCCACATGGCGCAGCCTCCAGG + Intronic
1134552635 16:15145114-15145136 CACCTCCCCGGGCAGCCAGCAGG + Intergenic
1134626213 16:15724628-15724650 AAGGACACGGGGCAGGCACCTGG + Exonic
1135108900 16:19675088-19675110 GACCACATGGGCAAGCCACCAGG + Intronic
1135735844 16:24931239-24931261 CAGCACACGGGCCAGCCTCCAGG - Exonic
1138037741 16:53625405-53625427 CCCCAGACGGGGCGGCCGCCAGG - Intronic
1138522165 16:57577400-57577422 CCCCACACAGTGCAGCCTCCAGG + Intronic
1141358984 16:83376934-83376956 CTCCACACAGGGCAGTCTCCAGG - Intronic
1142749981 17:1981561-1981583 CTGCACACGAGGCAGCCACAGGG - Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1143733433 17:8894259-8894281 CACAAGACGGGGCAGCCTCCTGG - Intronic
1144048881 17:11480461-11480483 CACCACACCGGACAGCTGCCAGG + Intronic
1146055588 17:29579192-29579214 CACCACCAGTGTCAGCCACCTGG + Intronic
1146717371 17:35097966-35097988 CACCACACTGTGCAGTCCCCTGG - Intronic
1147365086 17:39953824-39953846 CACCACACAGAGCACCCAGCAGG - Intergenic
1147546093 17:41402841-41402863 CATCAAACGGGGGAGCCTCCAGG + Intergenic
1152139172 17:78526213-78526235 CACCACATCGGGCAGCAGCCAGG - Intronic
1154202257 18:12307977-12307999 CACCACAAGGGGCAGCGAAACGG + Intronic
1160471124 18:79134568-79134590 CATCTCACAGGGCAGCCCCCTGG - Intronic
1160985667 19:1837455-1837477 GACCACACGGGGCAGAAACAGGG + Intronic
1161016094 19:1984412-1984434 CACCAGAAGGGCCACCCACCAGG - Intergenic
1161297647 19:3527811-3527833 CACCCCACGCAGCACCCACCTGG - Exonic
1161314471 19:3611432-3611454 CACATCACGGGGCACCCACTGGG - Exonic
1161905900 19:7156347-7156369 CACCACACTGGGCCTCCACATGG + Intronic
1163632089 19:18422709-18422731 CACCTGCCGGGGCAGCCACGCGG + Intronic
1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG + Intronic
1166878230 19:45911269-45911291 GAGCACACAGGGCAGCCTCCTGG - Intergenic
1202697045 1_KI270712v1_random:132859-132881 CACCAGCCGGTGCAGCCAGCCGG - Intergenic
927869793 2:26616227-26616249 GGCCACATGGGGCAGCCAGCTGG + Intronic
928823565 2:35391918-35391940 CACCCCTCGGGGCAGTCAGCAGG - Intergenic
929858085 2:45652165-45652187 CACCGCATGGCGCAGCGACCAGG - Exonic
930602207 2:53456018-53456040 CACCACACCTGGCAGCAGCCTGG + Intergenic
932262745 2:70341068-70341090 GACCACACGGGGATGCTACCTGG - Intergenic
934278207 2:91589873-91589895 CACCAGCCGGTGCAGCCAGCCGG - Intergenic
936385120 2:112022425-112022447 CTCTGCATGGGGCAGCCACCTGG + Intronic
936567307 2:113591501-113591523 CTCCACACAGGGCAGACTCCTGG + Intergenic
937711866 2:124987687-124987709 CAGCACTCGGAGCAGCCAGCTGG - Intergenic
940303340 2:152198886-152198908 AGCCACATGGGGAAGCCACCAGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
941625147 2:167823119-167823141 CACCCCATGGGGCCCCCACCTGG - Intergenic
942838399 2:180329334-180329356 CACCACCTGGGGCAGCCAAGGGG + Intergenic
944727116 2:202482825-202482847 CACCACACCCGGCTGCTACCTGG + Intronic
947364641 2:229381331-229381353 CACAAAACTGGGCAGCCATCTGG + Intronic
947732056 2:232436753-232436775 CACCACGCGGGGCAGCTGCAGGG + Intergenic
947810872 2:233003247-233003269 CCCCACCTGGGGCAGCCACCAGG - Intronic
949030933 2:241796950-241796972 CAGCAAACGGGGCAGCCCTCAGG - Intronic
1170577508 20:17675581-17675603 CTCCACACAGGGTAGCCAACAGG + Intronic
1171139545 20:22729038-22729060 TCCCTCACAGGGCAGCCACCGGG + Intergenic
1175214157 20:57381747-57381769 CACATCACGGGCCAGCCACAGGG - Intergenic
1175361438 20:58414421-58414443 CCTCAGACGGGGCAGCCGCCGGG + Intronic
1176023689 20:62975254-62975276 CACCCCACGCAGGAGCCACCTGG + Intergenic
1176046011 20:63092970-63092992 GTCCACACGGCCCAGCCACCCGG + Intergenic
1176063046 20:63180533-63180555 CACCACTGGGGGCAGGCATCAGG - Intergenic
1176130974 20:63496730-63496752 CTCCAGACTGGGCAGCCTCCTGG - Intronic
1177558778 21:22723882-22723904 CACCACACCTGGCTGACACCAGG + Intergenic
1179719042 21:43305161-43305183 CACCACATGGCCCAGCGACCTGG - Intergenic
1180068734 21:45425555-45425577 CACCTCACAGGGCAGCCCACGGG - Intronic
1180174281 21:46080191-46080213 CACCCCCCGGGGCACCCACAAGG - Intergenic
1180179643 21:46112187-46112209 CAGCCCACCGGGCAGCGACCGGG + Exonic
1180829415 22:18893957-18893979 CACCACACGGGGACTACACCAGG + Intergenic
1181029352 22:20142473-20142495 CACCACTCAGGGCAGCCAGAGGG - Intronic
1183203629 22:36403183-36403205 CACCACACGCAGCAGCGCCCAGG + Intergenic
1183203652 22:36403329-36403351 CACCACACGCAGCAGCGCCCAGG + Intergenic
1183620097 22:38967142-38967164 CAGGACAGGGGGCAGCCCCCAGG + Intronic
1185209911 22:49564997-49565019 CACCACTCTGGGCAGGCAGCAGG - Intronic
1185418627 22:50722872-50722894 AGCCACACTGGGCAGCCACATGG - Intergenic
1203279505 22_KI270734v1_random:119262-119284 CACCACACGGGGACTACACCAGG + Intergenic
962134744 3:132722164-132722186 CACCCCGCGGGGCAGCGACCCGG + Exonic
966852026 3:184170425-184170447 CACCACACGCAGCAGCCTGCGGG + Exonic
970401156 4:15719105-15719127 CTCCACACCGAGAAGCCACCCGG - Intronic
982301556 4:153883733-153883755 CTCCACACGAGGCAGCCACTGGG + Intergenic
985621855 5:960131-960153 CACCACGCAGGGCAGGCACACGG - Intergenic
985667069 5:1186853-1186875 CACATCCTGGGGCAGCCACCAGG - Intergenic
988628060 5:32898947-32898969 CACCAAACTGGGCAGCCATTTGG - Intergenic
988960981 5:36371578-36371600 CACCCTACAGGGCAGCCACCTGG - Intergenic
990510838 5:56487859-56487881 CTGCACTCGGGGCAGCCAGCTGG + Intergenic
990907986 5:60823979-60824001 CACCACACTGTTCAGCTACCTGG + Intronic
992494851 5:77282177-77282199 CCCCACAGGGAGCAGCCACATGG + Intronic
993541588 5:89159236-89159258 CACAAAACTGGGCAGCCACTTGG + Intergenic
999045081 5:148458689-148458711 CACCACATGGGCCTGCCCCCAGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001159387 5:169300472-169300494 CCCCACGCGGGCCACCCACCTGG - Intronic
1002526486 5:179818565-179818587 GACCAGCCGGGGCAGCCACAGGG - Intronic
1002640915 5:180630258-180630280 CACCAGACAGGGCACCCACATGG + Exonic
1007687113 6:43673552-43673574 CGCCACACGGAGCGGCCAGCTGG + Intronic
1018786227 6:167110074-167110096 CACTGCACAGGGCAGACACCTGG + Intergenic
1019347999 7:539885-539907 CACCACACAGGGCAGCCGCCTGG - Intergenic
1019446696 7:1074945-1074967 CACCACACGGGGCAGCCACCAGG - Intronic
1019896685 7:3988571-3988593 CTCCACACCGGTCAGCCACACGG + Intronic
1020241559 7:6399078-6399100 CACCACACGGGACACCCAAGCGG - Intronic
1021877305 7:25060644-25060666 CACCACACAGCGCAGCCTCCTGG - Intergenic
1022339740 7:29456824-29456846 CAGCCCAGGAGGCAGCCACCAGG - Intronic
1023875216 7:44283031-44283053 CACCATACGGGGCAGTGACATGG + Intronic
1027281337 7:76611495-76611517 CACGACACGAGGCTGCCTCCTGG + Exonic
1028556681 7:92133704-92133726 AACCACACAGGGCAGCCTCCAGG + Intronic
1033090237 7:138378911-138378933 CCCCAGACGGGGCGGCTACCGGG + Intergenic
1034370814 7:150594826-150594848 CACAAAACTGGGCAGCCACTTGG - Intergenic
1034546179 7:151790950-151790972 CACCACTCCGGGCAGCCGCCTGG - Intronic
1044890417 8:96829176-96829198 CACCAAACAGGGCAGGCAGCTGG + Intronic
1048201034 8:132374017-132374039 CACCCCACAGGGCAGCCAGAGGG + Intronic
1048339732 8:133529409-133529431 CACCATAAGGGACAGCCAGCAGG - Intronic
1049172953 8:141173397-141173419 CAGCACGCGGCGCAGGCACCAGG - Intronic
1049398911 8:142416109-142416131 CACCACCCGGAGCAGACACTGGG + Intergenic
1049664538 8:143837111-143837133 CAGCACACGGGGCAGCCCCAGGG + Exonic
1051512333 9:17891871-17891893 CACCACACCCGGCTGCCAACTGG + Intergenic
1053150181 9:35738307-35738329 CCCCACACAGAGCAGCCATCTGG + Exonic
1058399317 9:104595347-104595369 GGCCACATGGGGAAGCCACCAGG - Intergenic
1060787696 9:126463653-126463675 CCCCTCAGGGGACAGCCACCTGG - Intronic
1061061557 9:128253195-128253217 CTCCACACGGGGCGCGCACCTGG + Intronic
1061285531 9:129620390-129620412 CACCACGCGGCGCCGCCCCCCGG + Exonic
1061877055 9:133549368-133549390 CACCTCACCAGGTAGCCACCTGG - Intronic
1062178019 9:135175140-135175162 CCCCAGGAGGGGCAGCCACCAGG - Intergenic
1062398290 9:136361439-136361461 CCCCTCCCGGGGGAGCCACCTGG - Intronic
1062418708 9:136467946-136467968 CACCCCACCGGGCAGCGACCTGG - Intronic
1062680531 9:137776830-137776852 CACCACAACGGGCAGGTACCTGG + Exonic
1185467175 X:361947-361969 CACCACACCTGGCAGGGACCTGG + Intronic
1187407565 X:19017456-19017478 AACCACTAGGGGCAGCCACTAGG + Intronic
1194355744 X:92882025-92882047 CACAAAACTGGGCAGCCACTTGG + Intergenic
1197421070 X:126237678-126237700 CACGACATGGGGCAGACCCCGGG - Intergenic
1198271359 X:135059135-135059157 CTCAACAAGGGGCAGCCACTGGG + Intergenic
1200664091 Y:5999007-5999029 CACAAAACTGGGCAGCCACTTGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic