ID: 1019446752

View in Genome Browser
Species Human (GRCh38)
Location 7:1075187-1075209
Sequence CTGAGCAATGACAAGCTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019446748_1019446752 10 Left 1019446748 7:1075154-1075176 CCAAACACGGGAGGGGTGTGGTT 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG 0: 1
1: 0
2: 0
3: 13
4: 138
1019446744_1019446752 18 Left 1019446744 7:1075146-1075168 CCTGAGGACCAAACACGGGAGGG 0: 1
1: 0
2: 2
3: 8
4: 82
Right 1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019446752 Original CRISPR CTGAGCAATGACAAGCTAGA CGG Intronic
901228837 1:7630787-7630809 CTGAGCACTGACAAGGAAGTGGG + Intronic
901689555 1:10963909-10963931 CTGAGCAAGGACGAGTGAGATGG - Intronic
904896187 1:33820180-33820202 CTCAGTAATGACACGCCAGAAGG - Intronic
908673588 1:66576304-66576326 CTCAGCAATGGGAAGCTACATGG - Intronic
908859760 1:68470881-68470903 CTGAGCAATCAGAAGACAGATGG + Intergenic
910388162 1:86706380-86706402 CTTAGAAATCAAAAGCTAGAAGG - Intronic
910762907 1:90752517-90752539 AGGAGCAATGACAAACGAGAGGG - Intergenic
913174073 1:116257804-116257826 CTGACCAAGGACAAGCTTCAGGG - Intergenic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916652006 1:166841287-166841309 TTGAACGATGACAAGCTACATGG - Intronic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917668115 1:177245551-177245573 CTGAGCAAAGACAAGCACAATGG + Intronic
1065206135 10:23359460-23359482 CCCAGCAATGACAAGGCAGATGG + Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1070873749 10:79781907-79781929 CTGAGTAATAACAACCTAGTTGG - Intergenic
1071640682 10:87304057-87304079 CTGAGTAATAACAACCTAGTTGG - Intergenic
1071654554 10:87433888-87433910 CTGAGTAATAACAACCTAGTTGG + Intergenic
1071715886 10:88094893-88094915 ATGAGCAAAGACAAGCCAGTGGG - Intergenic
1073111323 10:101064621-101064643 GTGAGCACTGTCAAGCTAGCAGG - Exonic
1080162137 11:29189717-29189739 CTGGGCAATGAAAATGTAGAAGG + Intergenic
1081988061 11:47321515-47321537 CTTAGCATTGACAAGCTATTGGG + Intronic
1084867317 11:72069799-72069821 CTGACCTATGAAAAACTAGAGGG + Intronic
1088592134 11:111413006-111413028 GTGAGCAATGCCACTCTAGAAGG + Intronic
1090945296 11:131424554-131424576 CTAAGCAATTGCAAACTAGACGG - Intronic
1091512145 12:1138658-1138680 GTGAACAATGACAAGAAAGAAGG + Intronic
1094147127 12:27242477-27242499 GAGAGCAAGGACAAGCAAGATGG + Intergenic
1097716465 12:62971613-62971635 CTGAGAAATGAAAAGGTTGAGGG - Intergenic
1097904427 12:64905451-64905473 CTGAGCAATGACAAACACCATGG + Intergenic
1098988761 12:77041760-77041782 GAGAGCAATTACATGCTAGACGG - Intronic
1100067005 12:90661255-90661277 CTGAGAATGGATAAGCTAGATGG + Intergenic
1100367006 12:93931180-93931202 CTGAGCACAGGCAAGTTAGATGG + Intergenic
1102520329 12:113474017-113474039 CTGTCCCCTGACAAGCTAGAGGG - Intergenic
1106097192 13:26658565-26658587 CTGGGCAATGAGGAGCTAGAAGG - Intronic
1106287441 13:28329801-28329823 CTGAGCATTGACAAACAAGGAGG - Intronic
1107328966 13:39276257-39276279 CTGAGCAATGACAAACCTGATGG + Intergenic
1108528406 13:51305126-51305148 CTGAGCAATTACATGATAGTGGG + Intergenic
1109230202 13:59747606-59747628 CTGAGAAATATCAAGCTGGAAGG + Intronic
1110733101 13:78904175-78904197 CAGAGCAGTGACAAGGTACAAGG - Intergenic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1114612415 14:24051681-24051703 GTCAGCAAGGACAAGCTGGAGGG + Intergenic
1116290154 14:43024159-43024181 CTGAGCAGCAAGAAGCTAGAAGG - Intergenic
1117480326 14:56137330-56137352 CAGAGCAATGACATGCTATGTGG - Intronic
1118059832 14:62123494-62123516 CTGATCAATGACAAGAAAGAAGG - Intergenic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1120212757 14:81650177-81650199 ATGAGCAATAACAAGGTAGGCGG - Intergenic
1121450355 14:94003122-94003144 CTGTGCAATGACAGGATAGGAGG - Intergenic
1123856342 15:24415930-24415952 CTGAGCCCTGCCAAGCCAGAGGG - Intergenic
1125399344 15:39283492-39283514 CCGAGCAATATCAGGCTAGAAGG - Intergenic
1128354125 15:66912669-66912691 CTGAGCATTCACAAGCTGCATGG - Intergenic
1129739306 15:77982322-77982344 CTGAGCAAGGACAAAATCGAGGG - Intergenic
1130992970 15:88887496-88887518 GACAGCAGTGACAAGCTAGATGG + Intronic
1131912474 15:97223700-97223722 CTGACCAATGACAAATGAGAAGG + Intergenic
1132782988 16:1638710-1638732 CTGAGCTGTGACATGCTAGCTGG - Intronic
1137613131 16:49832383-49832405 CTGAGCAAAGACAAGCTCCTGGG + Intronic
1140708530 16:77654309-77654331 CTAGGCAGTGACAAGCCAGATGG + Intergenic
1141392849 16:83678973-83678995 GTGAGCATTGAGCAGCTAGAAGG - Intronic
1145739894 17:27264603-27264625 CTGAGCAATAACAAGAGAAATGG - Intergenic
1145973292 17:28969665-28969687 CTGTGCAATTACATCCTAGAGGG - Intronic
1146512728 17:33464098-33464120 ATGAGCAATGACAGGCAACAGGG - Intronic
1150362165 17:64545836-64545858 CTGTGGAATGACAAGCTTCAAGG - Exonic
1153403087 18:4702733-4702755 CTGAGAAAGGACAATGTAGAGGG + Intergenic
1156731138 18:40194576-40194598 CTGAGGACTGCTAAGCTAGATGG - Intergenic
1159898365 18:74019025-74019047 CTGAGCAATGGCCATGTAGAAGG + Intergenic
929055706 2:37874523-37874545 CTGGGCAGTGACAAGCTGGGGGG + Intergenic
930052793 2:47229463-47229485 CTGAGCAGACACAAGCTAGAAGG + Intergenic
931582852 2:63796032-63796054 CTGAGCAATGAGACGTGAGAAGG + Intronic
932839017 2:75064374-75064396 CTGAGAGAGGACAAGTTAGACGG + Intronic
933013768 2:77097061-77097083 CTAATCAATGACAAGCTGGTAGG + Intronic
935743671 2:106172832-106172854 CTGAGGAATGACGAGGCAGATGG - Intronic
944874304 2:203945998-203946020 CTGAGCAATGGCAAGCAATGTGG + Intronic
947957033 2:234201107-234201129 GTGAGCACTGAGAAGCTACATGG - Intergenic
948530108 2:238598734-238598756 CTGAGCCAGGACAGGGTAGAAGG - Intergenic
1174267144 20:49340223-49340245 CAGTGCAGTCACAAGCTAGAGGG + Intergenic
1175525804 20:59632548-59632570 CTGAGCAAAGACAATTTTGAAGG + Intronic
1176107840 20:63397948-63397970 CTGAGCAGTGCCAGGCTGGAGGG + Intergenic
1176899444 21:14421084-14421106 CTGAGCTACCAAAAGCTAGAGGG - Intergenic
1176969714 21:15251548-15251570 GTTAACAATGACAAGCTTGAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183383044 22:37500016-37500038 CTGAGCAGTGACAGGCCACATGG + Intronic
1183387359 22:37522575-37522597 CTGAGACCTGAAAAGCTAGAAGG - Intergenic
952043078 3:29283122-29283144 CAGAGCAAGGACAAGTTAAAAGG + Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
955471202 3:59288118-59288140 CTCTGCAATGACAAGTTTGATGG - Intergenic
955926501 3:64011062-64011084 ATGTGCAATAACAAGCTTGAAGG - Intronic
957500489 3:81051268-81051290 CTGAGCAAGAACATGGTAGAAGG - Intergenic
959130835 3:102354250-102354272 CTTAGAAATCACAAGCTTGATGG + Intronic
961041040 3:123678492-123678514 CTGAGCACTGACAAGCATGAGGG - Intronic
963496085 3:146063108-146063130 CTAATCAATGGCAAGTTAGATGG + Intergenic
967752278 3:193128395-193128417 CTGAGGTATGACAAGCTAGTAGG - Intergenic
968515945 4:1015682-1015704 CTGAGCAGTGACAGGAAAGAGGG + Intronic
977196016 4:94060996-94061018 GTCAGGAATGACAAGATAGATGG - Intergenic
977561882 4:98541111-98541133 CTGAGCACCAACAAGGTAGATGG - Intronic
981132245 4:141170266-141170288 CTGAGAAATTACAAGCTACTTGG - Intronic
981926008 4:150139967-150139989 CTAAGCAGTGACATTCTAGAAGG - Intronic
989406797 5:41070365-41070387 TTGAGCAATTTCAAGCTACATGG + Intronic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993835249 5:92811939-92811961 CAGATCAAAGGCAAGCTAGAAGG - Intergenic
994749157 5:103717226-103717248 AAGAGAAATAACAAGCTAGAGGG - Intergenic
995306714 5:110659558-110659580 ATGAGTAATGACAAGATACAAGG + Intronic
995696977 5:114890160-114890182 CTGTAAAATGACAGGCTAGAAGG - Intergenic
995734288 5:115282346-115282368 CTGAGCAAAGCAAAGATAGATGG - Intronic
996077802 5:119217926-119217948 TTGAGCAATGACTGGCTAAAGGG + Intronic
998147760 5:139739993-139740015 CTGAGCTAGGACCAGCTAGCTGG + Intergenic
998749653 5:145305625-145305647 CTGACCAATGAAAAGCTGGATGG - Intergenic
1001114371 5:168926613-168926635 TTAAGCAATGACAAGCTAAAAGG - Intronic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1002650730 5:180691250-180691272 CTGAGATAAGACAAGGTAGAAGG + Intergenic
1003009637 6:2414479-2414501 TTGAGGAATTACAAGCTATAGGG + Intergenic
1003160742 6:3632079-3632101 TTGAGCAATGACAATATTGATGG + Intergenic
1003477840 6:6500976-6500998 CTGACTAATGACGAGTTAGATGG - Intergenic
1003630771 6:7784832-7784854 CTGTGCAATCCCAAGGTAGAAGG - Intronic
1004149031 6:13097600-13097622 CTGCTCTATGACAGGCTAGATGG - Intronic
1005843684 6:29761422-29761444 CTCAGCAATGACAAGATATCAGG - Intergenic
1006040731 6:31252429-31252451 CTGAGCAATGCCCAGCTCCAGGG - Intergenic
1007194495 6:40048956-40048978 CTGAGCAATGCCCAGCCAGCAGG - Intergenic
1008489645 6:52072806-52072828 CTGAGCATTTATAAGGTAGAAGG - Intronic
1012468679 6:99545398-99545420 CTGAAAAATGAGATGCTAGAAGG - Intronic
1013806762 6:114004967-114004989 CTGACCAATGAGAAGCCCGACGG + Intronic
1017061271 6:150487344-150487366 CTCAGCAATGTGAAACTAGAAGG + Intergenic
1018270946 6:162076926-162076948 CTGAGCAATGACAGGCATGTGGG - Intronic
1018958331 6:168428295-168428317 TTGAGCAAAGACAAGCTCGGTGG + Intergenic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1019797571 7:3063157-3063179 CAGAGCAAACACAAGCTAGAAGG + Intergenic
1021348370 7:19556530-19556552 CTGAACAAAAACAAGCTATAAGG + Intergenic
1028752155 7:94394067-94394089 CTCAGCAAAGGCAAGCTAGGAGG + Intergenic
1032581246 7:133105361-133105383 CTGAGCTAGGAAAAGATAGATGG + Intergenic
1034429647 7:151034807-151034829 CTGGGAGATGACAAGCTTGAAGG - Exonic
1037512652 8:19599304-19599326 GTGAGCAGTGACAAGATACAAGG + Intronic
1037843320 8:22261170-22261192 CTGAGCCATGACAATGTAGATGG + Intergenic
1038390374 8:27192908-27192930 CTGAGAAATGATAATCAAGATGG + Intergenic
1039117217 8:34104647-34104669 CTGAGAAATGAAAAACTATAAGG - Intergenic
1040661785 8:49583044-49583066 TTGAGCACTGACAAGCATGACGG + Intergenic
1044298387 8:90554993-90555015 CTGAGCTCTGAGAAGCTAGTAGG - Intergenic
1044582824 8:93839122-93839144 CTGAGCAGTAAAAAGCTAGAAGG - Intergenic
1045829032 8:106435772-106435794 CTGAGCCTTGAGAAGATAGAGGG - Intronic
1047636772 8:126772184-126772206 ATGAGCAATAAAAAGCAAGAAGG - Intergenic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1052292089 9:26853631-26853653 CTGAGCAATGACGAGTGAAATGG + Intronic
1052447671 9:28585833-28585855 CTCAACAATGACAATCTTGAAGG - Intronic
1053373726 9:37586137-37586159 CTGAGCAATGACCAGCTCAATGG + Intronic
1056737187 9:89219971-89219993 CAGAGCAATGAAAAGCCAGAGGG + Intergenic
1059476578 9:114552313-114552335 CCAAGGAATGACAAGCTAGCAGG - Intergenic
1060038343 9:120278347-120278369 GTGGGCAATGGGAAGCTAGAAGG + Intergenic
1060621122 9:125067661-125067683 ATGAGAAATGACAAGCTGGGTGG - Intronic
1060917639 9:127400574-127400596 CTGTGCAGTGACAAACCAGAGGG + Intronic
1062027017 9:134345229-134345251 CTGTGCAAATACCAGCTAGAGGG - Intronic
1062356972 9:136169688-136169710 CTGGGCACTGACACCCTAGATGG + Intergenic
1185724420 X:2407964-2407986 CAGAGCATTGAGAATCTAGATGG + Intronic
1188485926 X:30682203-30682225 CTGGGCAATGAGAAATTAGATGG + Intronic
1190077025 X:47324616-47324638 CTGAGCAGTTACCAGCTTGAAGG + Intergenic