ID: 1019447388

View in Genome Browser
Species Human (GRCh38)
Location 7:1078495-1078517
Sequence GGCAGGCGCTGCGCTCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019447383_1019447388 -4 Left 1019447383 7:1078476-1078498 CCAGCCAGGCTCTGCACAAGGCA 0: 1
1: 1
2: 3
3: 33
4: 267
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192
1019447378_1019447388 14 Left 1019447378 7:1078458-1078480 CCACAGCAAGCAGGGACCCCAGC 0: 1
1: 0
2: 1
3: 40
4: 346
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192
1019447375_1019447388 30 Left 1019447375 7:1078442-1078464 CCTGGGGTTAAATCTTCCACAGC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192
1019447382_1019447388 -3 Left 1019447382 7:1078475-1078497 CCCAGCCAGGCTCTGCACAAGGC 0: 1
1: 0
2: 1
3: 38
4: 291
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192
1019447385_1019447388 -8 Left 1019447385 7:1078480-1078502 CCAGGCTCTGCACAAGGCAGGCG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192
1019447380_1019447388 -2 Left 1019447380 7:1078474-1078496 CCCCAGCCAGGCTCTGCACAAGG 0: 1
1: 0
2: 5
3: 27
4: 349
Right 1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG 0: 1
1: 0
2: 1
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019447388 Original CRISPR GGCAGGCGCTGCGCTCAGGT GGG Intronic
900287447 1:1908518-1908540 GGCAGGCCCTGGGCTCGGGCGGG - Intergenic
900929628 1:5728418-5728440 TGCAGGCGCTGCTGCCAGGTAGG - Intergenic
900984410 1:6065233-6065255 GGCAGGCGCTGCAGCCAGGGTGG - Intronic
902331556 1:15733524-15733546 GGCAGGCGCTGCACTCTGTTTGG - Intronic
903041649 1:20535189-20535211 GGGAGGCGCTGCCTTCAGGCCGG + Intergenic
904007824 1:27373177-27373199 GGAGGGCCCTGCCCTCAGGTAGG + Exonic
905293923 1:36942322-36942344 GGCAGACGCTGCTATCAGCTCGG - Intronic
910244087 1:85120326-85120348 GGCAGGCGGTGATTTCAGGTGGG + Intronic
912824676 1:112894773-112894795 GGCAGGCCCTGCACTCAGACTGG + Intergenic
914287019 1:146236474-146236496 GGCAGGCTCTTCTCTCTGGTGGG + Intergenic
914548051 1:148687216-148687238 GGCAGGCTCTTCTCTCTGGTGGG + Intergenic
919934949 1:202245281-202245303 GGCAGAGGCTGCTCTGAGGTGGG + Intronic
922561080 1:226570047-226570069 GGGAGGGGCGGGGCTCAGGTTGG - Intronic
924458135 1:244234465-244234487 GGCAGGCACTGCGCTTGGCTCGG - Intergenic
1064433374 10:15290285-15290307 GGCAGGGGATGGGGTCAGGTGGG - Intronic
1065368403 10:24956838-24956860 GACAGGGGCAGAGCTCAGGTGGG - Intergenic
1071601777 10:86962041-86962063 GACAGGCTCTGGGCTCAGGCTGG - Intronic
1073177305 10:101564483-101564505 TCAAGGCGCTGCGCTGAGGTTGG + Intergenic
1075456952 10:122591045-122591067 GGCAGAGGCTGTGCTCAGGCAGG + Intronic
1076738636 10:132469670-132469692 GGCGGGCTCTGTGCTCTGGTGGG + Intergenic
1076890469 10:133280831-133280853 GGCAGGCGCTGGGCTGAGCTGGG + Intronic
1076890492 10:133280901-133280923 GGCAGGCGCTGGGCTGAGCTGGG + Intronic
1076890528 10:133281025-133281047 GGCAGGTGCTGGGCTGAGCTGGG + Intronic
1076890550 10:133281095-133281117 GGCAGGTGCTGGGCTGAGCTGGG + Intronic
1077217264 11:1400198-1400220 GGCAGGCGCTGGGCTCTGCGTGG + Intronic
1077250684 11:1559369-1559391 GGCACGCGCTGGGCCCAGGCAGG + Intronic
1077461717 11:2714142-2714164 GGCAGGCGCAGTGCCCAGGCTGG + Intronic
1080106041 11:28512617-28512639 GGCAGGCCCTGCACTCAGAGTGG - Intergenic
1081611312 11:44565181-44565203 GGAAGGCGCTGAGCCCAGGCTGG + Intronic
1083573122 11:63770314-63770336 GGCAGGCCCTGCGCTCAGGGGGG + Intergenic
1084072348 11:66744682-66744704 CGCAGGCGCGGCGGGCAGGTGGG + Intronic
1084072475 11:66745218-66745240 GGAAGGCGCTGGGCTCCGGCAGG - Intronic
1084199365 11:67545162-67545184 GGCAGGCACAGCGGGCAGGTGGG - Intergenic
1091678213 12:2506906-2506928 GGCAGACGCTCTGCTCAGGGAGG - Intronic
1095753004 12:45730445-45730467 GGCGGGCGCGGGGCTCAGGCTGG - Intronic
1097848437 12:64389387-64389409 AGCAGGCCCTGCGCCCAGTTTGG + Intronic
1098519739 12:71421449-71421471 GGCAGGGGCTGGGAACAGGTGGG - Intronic
1104236666 12:126944880-126944902 GGCAGACGTTGCGCTGAGCTGGG - Intergenic
1104697066 12:130871894-130871916 GGCGGTCGCTGCGCTTAGGGTGG - Exonic
1105402561 13:20108927-20108949 GGCAGGTGCTTCTCCCAGGTTGG + Intergenic
1106837332 13:33649020-33649042 GGCAGGCGATCACCTCAGGTCGG - Intergenic
1107542340 13:41402986-41403008 GGCTGGGCCTGAGCTCAGGTAGG - Intergenic
1112077776 13:95931722-95931744 AGCAGGCCCTGCACTCAGGCCGG - Intronic
1112522512 13:100109724-100109746 GGCAGGGGCTTGGCTCGGGTTGG + Intronic
1112652730 13:101416392-101416414 GCCAGGCGCGGCGCCCAGGGCGG + Intronic
1113499761 13:110764039-110764061 GGGAGGGGCTGCACTGAGGTTGG + Intergenic
1113694107 13:112331784-112331806 GGCAGGCGCTGGGGACAGCTTGG - Intergenic
1117566817 14:57001793-57001815 GGCAGGCACTGCCCTCTGGGTGG - Intergenic
1121444698 14:93971210-93971232 GGCAGGCTCTGCGCACAGCCCGG - Intronic
1122037008 14:98956294-98956316 GGCAGGTGCTGGCCTGAGGTCGG + Intergenic
1122059116 14:99124790-99124812 GGCCAGCGCTGCCCACAGGTGGG + Intergenic
1123033138 14:105460528-105460550 GGCAGGTGCTGGGCCCTGGTAGG - Intronic
1123500765 15:20878642-20878664 GGCTGGCGTTGCGCTCTGCTCGG + Intergenic
1123558013 15:21452335-21452357 GGCTGGCGTTGCGCTCTGCTCGG + Intergenic
1123594241 15:21889616-21889638 GGCTGGCGTTGCGCTCTGCTCGG + Intergenic
1124636449 15:31367763-31367785 GCCAGGCGCTGTGCTGAGGCCGG + Intronic
1125729451 15:41884768-41884790 GGCAGGAGCTGAGGTCAGGGGGG - Intronic
1127870550 15:63069363-63069385 GGCAGGCTTTCCCCTCAGGTAGG - Intronic
1127995503 15:64151445-64151467 GGTAGGCGCTTAACTCAGGTTGG + Intergenic
1128542536 15:68545805-68545827 GGCAGGAGCTGCCATCAGGTGGG + Intergenic
1129194201 15:73954523-73954545 AGCAGGCGCTGAGCTGAGGAGGG + Intergenic
1129462411 15:75706181-75706203 GGAAGGGGCTGCTCTTAGGTGGG + Intronic
1129600839 15:76997076-76997098 GGCAGGATCTGGGCACAGGTAGG + Intronic
1129726312 15:77903491-77903513 GGCCGGGGCTGGGCACAGGTGGG - Intergenic
1130274358 15:82468850-82468872 GGCAGGGGCTGGGCACAGGTGGG - Intergenic
1130466704 15:84196224-84196246 GGCAGGGGCTGGGCACAGGTGGG - Intergenic
1130497560 15:84477312-84477334 GGCAGGGGCTGGGCACAGGTGGG + Intergenic
1130589000 15:85200817-85200839 GGCAGGGGCTGGGCACAGGTGGG - Intergenic
1202966365 15_KI270727v1_random:179507-179529 GGCTGGCGTTGCGCTCTGCTCGG + Intergenic
1132461863 16:59414-59436 GCCACGCTCTGCTCTCAGGTAGG - Exonic
1132761002 16:1508686-1508708 GGCTGGCACTGCGCCCAGGTGGG - Intronic
1140779117 16:78277642-78277664 GACAGGCGCTGCTCTCTGGCAGG + Intronic
1142042659 16:87905089-87905111 GGCAGGCGCTGGGCTGGGGGGGG - Intronic
1142401576 16:89861462-89861484 GGCAGGCCCTGCGTTTCGGTGGG - Intronic
1143508319 17:7381569-7381591 GCCTGGGGCTGAGCTCAGGTAGG + Intronic
1144435937 17:15240730-15240752 GGCAGGCACTGCTCTCATGGAGG + Intronic
1144834204 17:18148464-18148486 AGCAGGTGCCGGGCTCAGGTTGG - Intronic
1148438283 17:47698683-47698705 GGCTGGCGGTGGGCTCAGGTTGG - Exonic
1148647802 17:49229401-49229423 GGCAGGCACTGCTTTTAGGTGGG - Intronic
1149575212 17:57707147-57707169 GGCAGGCAGGGAGCTCAGGTAGG - Intergenic
1150501333 17:65653619-65653641 GGCAGGAGCTGGGCACAGGAAGG + Intronic
1151344949 17:73495733-73495755 GGGAGGAGCTGGCCTCAGGTCGG + Intronic
1152690796 17:81716862-81716884 GGCAGGTGCTGTGCACAGGCAGG + Intronic
1154954728 18:21242605-21242627 GGCAGGCACGGCTCCCAGGTTGG - Intronic
1160731825 19:644705-644727 GGAGGGCGCTGGGCACAGGTGGG - Intergenic
1160780312 19:874799-874821 GGCAGAGGCTGCGCTGAGCTGGG + Intronic
1160833540 19:1114061-1114083 AGCAGCAGCTGGGCTCAGGTGGG + Intronic
1161083740 19:2324240-2324262 GGCGGGCCCTGCGCCCAGGACGG - Intronic
1161524943 19:4748390-4748412 GGGAGGGGCGGGGCTCAGGTGGG - Intergenic
1163085918 19:14979709-14979731 GGCCGGCCCTGCGCTCACGTGGG + Intronic
1163419484 19:17206135-17206157 GGCAGGCGCTGCAGACAGGTGGG + Exonic
1165957037 19:39507460-39507482 GGCCGGCGCTGCGCTCTTGCTGG + Exonic
1166685604 19:44794286-44794308 GTCAGGCGCTGGTCTGAGGTTGG + Intronic
1168412153 19:56146885-56146907 TGCAGGCGCTGCGGTCCGGGAGG + Exonic
925607338 2:5672924-5672946 GGCAGGCTCGGGGCTCAGCTGGG + Intergenic
926202814 2:10813432-10813454 GGCTGGCAATGCGCTCACGTGGG + Intronic
926223605 2:10952192-10952214 GGCAGTAGCTGAGCTCAGGGTGG + Intergenic
926298592 2:11586279-11586301 TGCAGGAGCTCCGCTCTGGTGGG + Intronic
926753258 2:16216445-16216467 GGCAGGATCTGAGCCCAGGTCGG + Intergenic
932331362 2:70900218-70900240 CGCAGCCGCTGCGCTCCGGCCGG - Intergenic
934323430 2:91985925-91985947 GGCAAGGGCTGGGCTCAGGCTGG - Intergenic
935990155 2:108712256-108712278 GGCAGGCCCTGCACTCATGAGGG - Intergenic
937320606 2:120958560-120958582 GGCAGGGGCTGAGCGCAGGATGG - Intronic
938259221 2:129883300-129883322 GGCAGGCAGAGCCCTCAGGTTGG - Intergenic
938460039 2:131491327-131491349 GGCAGGAACTGGGCCCAGGTGGG + Intronic
938765966 2:134460592-134460614 GGCAGGGGTGGCGCTCAGGCTGG - Intronic
942351541 2:175058046-175058068 GGCAGGCACTGCGTTGGGGTGGG + Intergenic
946495466 2:220191938-220191960 GGCAGGAGCTGGGAACAGGTGGG + Intergenic
947670242 2:231931113-231931135 TGCAGGCTCTGAGCTGAGGTTGG - Intergenic
949018537 2:241727217-241727239 GTCAGCCACTGCGCTCAGCTGGG + Exonic
1169488335 20:6052095-6052117 GCCTGGCTCTGCGCTCAGGCCGG + Intronic
1170569118 20:17622927-17622949 AGAGGGCGCTGCGCTCAGGCTGG - Intronic
1172428604 20:34872828-34872850 GGCAGGCGCTGCGCTGCTGGGGG - Exonic
1173971026 20:47152468-47152490 GGATGGGGCTGCCCTCAGGTGGG - Intronic
1174035735 20:47667308-47667330 GGCAGGTGCTACACCCAGGTGGG + Intronic
1174172175 20:48624553-48624575 GGCAGGTGGTGAGTTCAGGTGGG - Exonic
1175400375 20:58696756-58696778 GTCAGGCCCTGCGCTGAGGCAGG + Intronic
1175895150 20:62332792-62332814 GGCAGGCCCTGGGGTCAGGGAGG - Intronic
1178465189 21:32841491-32841513 GGCAGGCCCTGCACTCATGAGGG - Intergenic
1179435183 21:41357801-41357823 GGGAGGCGCTGCTCTCAGGAGGG + Intergenic
1180083003 21:45495050-45495072 GACAAGAGCTGCGCTCAGGCAGG - Intronic
1180854907 22:19039526-19039548 GGGAGGCACTGGGCCCAGGTGGG + Intronic
1180949455 22:19714627-19714649 GGCAGGCGCTGGGCTCACCTGGG - Exonic
1181487271 22:23239191-23239213 TGCAGGGGCTGTGCTCAGGAAGG + Intronic
1181562931 22:23716162-23716184 GGCAGGCGCTGCCCAGAGCTGGG - Intergenic
1182036249 22:27200713-27200735 CACAGGCTCTGGGCTCAGGTTGG + Intergenic
1183953863 22:41367842-41367864 GACAGGTGCTGTGCTCATGTGGG + Intronic
1184104168 22:42357872-42357894 GGGAGGCTCTGCGCTTAGCTAGG + Intergenic
1184556979 22:45238793-45238815 GGCAGGCTCTGAGGTCAGGCTGG + Intronic
950601207 3:14037273-14037295 GGCAGGCCCTGCACTCAGAGTGG + Intronic
950613147 3:14138943-14138965 GGCAGGCTCTGAGCTGAGGAAGG + Intronic
952762078 3:36923748-36923770 GGCAGGAGCTACACTCTGGTGGG + Intronic
952887483 3:38020507-38020529 GGCAGGCTCTGGGAGCAGGTTGG - Intronic
953657086 3:44862284-44862306 GGGCGGCGCTGCGGTCAGCTGGG + Intronic
953796969 3:45993297-45993319 GGCAGAAGCTGTGCTCAGTTAGG - Intronic
955161503 3:56468540-56468562 GCCAGGCGCTGCGCTCGGCGGGG + Intergenic
956651463 3:71508397-71508419 GGCAGGCGCTGGGCTCGTGAGGG + Intronic
961558179 3:127710889-127710911 GGCAGCCGCTGCGCCCAAGGTGG + Intronic
961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG + Exonic
963837416 3:150071071-150071093 GGCAGGAGCTGAGGTCAGGAAGG + Intergenic
964087469 3:152835239-152835261 GCCAGGAGCTGAGCTCAGGGTGG + Exonic
966925808 3:184643876-184643898 GGCAGCCACTGTCCTCAGGTGGG - Intronic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
968469666 4:773637-773659 GGCAGGCCCTGCACTCAGAGCGG + Intergenic
968549637 4:1215521-1215543 GGAACGGGCTGTGCTCAGGTCGG - Intronic
968549643 4:1215562-1215584 GGAAAGGGCTGTGCTCAGGTCGG - Intronic
968549649 4:1215603-1215625 GGAACGGGCTGTGCTCAGGTCGG - Intronic
969273477 4:6118735-6118757 GGCAAGCGCAGAGCTCTGGTTGG + Intronic
969342616 4:6551713-6551735 AGCAGGGGCTGAGCTCAGCTGGG - Intronic
969634619 4:8359746-8359768 GGAAGGCGAGGCGCTCAGGGAGG - Intergenic
970967907 4:21948963-21948985 GGCAGGGGCGGCGCTCACGAGGG - Intergenic
982746009 4:159104066-159104088 GGCGGGCGCAGCGCGCAGGGCGG + Intergenic
984441365 4:179774565-179774587 GGAAGGCGTGGCGCTCAGGGAGG - Intergenic
985590079 5:759970-759992 GGCCGGCGCTGGGCTCAGGACGG - Intronic
985727310 5:1523262-1523284 GGCAGGCCCTGCGCGCAGCCCGG - Intronic
985752187 5:1686950-1686972 AGCAGGCGCAGCTCTCAGGTGGG - Intergenic
987258435 5:16180004-16180026 GGCCGGCCCCGCGCTCACGTCGG + Intronic
990428587 5:55712492-55712514 GGCAGCCGGCGCGCCCAGGTGGG + Exonic
995052728 5:107724755-107724777 GGCCGGGGCTGCGGGCAGGTGGG - Intergenic
997135836 5:131324569-131324591 GGCAGGCACTGGTCTCATGTGGG + Intronic
1001163097 5:169338732-169338754 TGCAGGAGCTGCGGTCAGGGAGG + Intergenic
1001480963 5:172089036-172089058 GGCAGGCTCTGGGCTCAGGCTGG - Intronic
1002000765 5:176195217-176195239 GGCTGGGGATGCGCTCTGGTTGG - Intergenic
1002253572 5:177943753-177943775 GGCTGGGGATGCGCTCTGGTGGG + Intergenic
1003011013 6:2427599-2427621 GACAGGAGCTGTGCTCAGGTTGG + Intergenic
1004432388 6:15556701-15556723 GGCAGGCGAGGAGCTCAGGGAGG - Intronic
1004561893 6:16760314-16760336 GGCAGGCGCTGCCCTGAGCCGGG - Intronic
1005997485 6:30940220-30940242 GACAGCCGCTGAGCTGAGGTGGG + Intergenic
1006518181 6:34556072-34556094 GGCAGAGGCAGCACTCAGGTTGG + Exonic
1006841088 6:37028197-37028219 GGCAGGAGCTGGGTTCAGGGTGG - Exonic
1007406611 6:41639242-41639264 GGGAAGCGCTGGGCTCTGGTTGG - Intronic
1009241817 6:61193963-61193985 GGCAGGAGCTGAGAACAGGTGGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1015926050 6:138311493-138311515 CTCAGGCGCTGCTCTCAGGTAGG + Exonic
1018903885 6:168064201-168064223 GGCAGTCGCTGAGGTCAGGGTGG - Intronic
1019068361 6:169321639-169321661 GGCAGGGGCTGCCCTCAGCATGG + Intergenic
1019131904 6:169883118-169883140 GCCAGGCGCTGGGCTCAGGCTGG - Intergenic
1019279407 7:192585-192607 GGCGGGAGCTGCGCTCGGGGCGG + Intergenic
1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG + Intronic
1022384823 7:29890890-29890912 GGCCTGCCCTGTGCTCAGGTGGG + Intronic
1022528482 7:31052921-31052943 GTCTGGCGCTGCGCTCGGGGCGG + Intronic
1023050388 7:36246133-36246155 GGCAGGCACTGGTCTCAGGTTGG - Intronic
1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG + Exonic
1024639375 7:51316914-51316936 GGCGGGGGCGGCGCTCCGGTGGG - Intergenic
1025234681 7:57226678-57226700 GCCAGGTGCTGTGCTCAGGGCGG + Intergenic
1033374694 7:140746894-140746916 GGCAGGCCTTGGACTCAGGTAGG - Intronic
1034474073 7:151272830-151272852 GGCAGGCGGTGGCCTCAGCTTGG + Intronic
1034692279 7:153023381-153023403 GGCAGGTGCTGCAGTGAGGTCGG + Intergenic
1035605286 8:926402-926424 GGCAGGCCCTGCCTCCAGGTCGG + Intergenic
1036520695 8:9489071-9489093 GACAGGCGCTGTGCTCAATTTGG + Intergenic
1039432647 8:37537256-37537278 GGCAGGCACTGCACTGGGGTGGG + Intergenic
1048972775 8:139654546-139654568 GCCAGGCTCTTCCCTCAGGTAGG + Intronic
1049029700 8:140025074-140025096 GGGTGGCGCTGCACTCAGGATGG + Intronic
1049795619 8:144496124-144496146 GCCAGGCGCTGCCCTAAGGCTGG - Intronic
1056090640 9:83202046-83202068 GGCAGGCCCTGCACTCATGAGGG + Intergenic
1056857001 9:90140314-90140336 GGCAGGGGCTGTGCCAAGGTGGG - Intergenic
1057045336 9:91881915-91881937 GGCAGGCGAGGCCCTCAGGCTGG + Intronic
1060243722 9:121926497-121926519 GCCAGGCGCTGGGCTGAGGACGG + Intronic
1060663650 9:125419668-125419690 GCCAGGCTCTGAGCTCAGTTAGG - Intergenic
1061076330 9:128343636-128343658 GAAAGGCCCTGCCCTCAGGTTGG + Intronic
1061314831 9:129788419-129788441 GACAGACGCTGGGCTCATGTGGG - Intergenic
1061401036 9:130368488-130368510 GGCAGGCGCTGCCCTGAAATTGG + Intronic
1062097293 9:134709966-134709988 GGCAGCTCCTCCGCTCAGGTGGG - Intronic
1062153326 9:135032631-135032653 GGCAGGAGCTGCTCTCACCTGGG - Intergenic
1062333750 9:136056000-136056022 GGAAGGCGTTGCGCGGAGGTGGG - Intronic
1062362236 9:136193516-136193538 GGCGCGCGCTGCGCTCCGATCGG + Intergenic
1062387573 9:136319086-136319108 AGCGGGGGCTGTGCTCAGGTTGG - Intergenic
1062472762 9:136713464-136713486 GCCAGGCCCTGAGCTCAGGCAGG - Intronic
1062532948 9:137009689-137009711 GGCAGGGGCAGCGTTCAGGCTGG - Intronic
1062538867 9:137032714-137032736 GGCACGCGCTGGGCTCCTGTGGG - Exonic
1187362561 X:18641979-18642001 GGCAGGCGCCGAGCTGAGGCAGG + Exonic
1189041259 X:37543584-37543606 GGCAGGCTCTGCGCGGAGATGGG + Intronic
1189848555 X:45157881-45157903 GCCAGGCCCTACGCGCAGGTGGG + Exonic
1197648513 X:129041649-129041671 GCCAGGCCCTGCGCTCAGTGTGG + Intergenic
1198060894 X:133044452-133044474 GGCAGGCCCTGCACTCAGAGTGG + Intronic