ID: 1019448401

View in Genome Browser
Species Human (GRCh38)
Location 7:1083226-1083248
Sequence CTGAAGGCGCGTGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019448401_1019448412 14 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448412 7:1083263-1083285 CCAGGGGCTGACGGGCCAGATGG No data
1019448401_1019448408 5 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448408 7:1083254-1083276 GAGTCACGCCCAGGGGCTGACGG 0: 1
1: 0
2: 0
3: 17
4: 175
1019448401_1019448406 -3 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448406 7:1083246-1083268 CAGTGCTGGAGTCACGCCCAGGG No data
1019448401_1019448405 -4 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448405 7:1083245-1083267 TCAGTGCTGGAGTCACGCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 128
1019448401_1019448409 6 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448409 7:1083255-1083277 AGTCACGCCCAGGGGCTGACGGG 0: 1
1: 0
2: 2
3: 42
4: 189
1019448401_1019448407 -2 Left 1019448401 7:1083226-1083248 CCAGCAGCCGCACGCGCCTTCAG 0: 1
1: 0
2: 0
3: 2
4: 108
Right 1019448407 7:1083247-1083269 AGTGCTGGAGTCACGCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019448401 Original CRISPR CTGAAGGCGCGTGCGGCTGC TGG (reversed) Intronic
901143919 1:7052732-7052754 CTGAAGGCCAGTCAGGCTGCTGG - Intronic
901544104 1:9942972-9942994 CTCAAGGCGTGTCCGGATGCGGG - Intronic
902818558 1:18929714-18929736 CTGAAGGGGTGTGTGGCTGGGGG - Intronic
904470825 1:30735156-30735178 CAGAAGGTGAGTGTGGCTGCAGG - Exonic
905847210 1:41242526-41242548 CTGAGGCCGCGTGGGGCTGGTGG + Intergenic
906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG + Exonic
906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG + Intergenic
912263365 1:108131005-108131027 CAGGAGGCCCGTGTGGCTGCAGG - Intergenic
915342617 1:155184710-155184732 CATAAGGGGCATGCGGCTGCGGG - Exonic
918388852 1:184037415-184037437 CTGAGGGCGGCGGCGGCTGCCGG + Exonic
919716439 1:200782459-200782481 CTGAAGTGGGGTGGGGCTGCGGG - Intronic
1062890528 10:1056646-1056668 CTGAAGACCCCTTCGGCTGCTGG - Intronic
1063372805 10:5532750-5532772 ATGAAGGCACCTGCTGCTGCCGG - Intergenic
1065660240 10:27998786-27998808 CTGCAGGTGAGTGCGGCTGGGGG - Intronic
1067669635 10:48307003-48307025 CCGAGGGGGCGTGGGGCTGCGGG + Intronic
1070749347 10:78954791-78954813 GTGAAGGAGCCTGCTGCTGCTGG + Intergenic
1072412328 10:95214868-95214890 CTGAAGCAGTGTGTGGCTGCAGG + Exonic
1077637892 11:3855779-3855801 CTGAGGGCGCGGGCGTCTCCGGG - Exonic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1085445608 11:76598738-76598760 CAGTAGCCGCGTGCGGCTGGTGG - Intergenic
1086953776 11:92915718-92915740 CTGGAGGCGCGAGCCGCTGTAGG - Intergenic
1089596701 11:119585193-119585215 CTGGAGGCAGGTGAGGCTGCCGG - Intergenic
1102955178 12:117054362-117054384 CTGAAGACCCCTGCTGCTGCTGG + Intronic
1103017548 12:117507613-117507635 CTGAAGGCAGATGGGGCTGCTGG - Intronic
1105578551 13:21674156-21674178 CTGGAGGCGCGCGCAGCGGCAGG + Intronic
1114460877 14:22885407-22885429 CTGAAGGCTGGTGGGACTGCTGG + Intronic
1118716364 14:68562968-68562990 CGGAAGGCCCGGGCTGCTGCCGG + Intronic
1119985544 14:79133026-79133048 CTGAAGGCGCTGGCAGCTGAAGG + Intronic
1120193594 14:81461040-81461062 CTGAAAGCGTCTGCAGCTGCAGG + Intergenic
1123827881 15:24101555-24101577 CTGAAGGGAAGTGCGGGTGCGGG + Intergenic
1123857369 15:24427025-24427047 CTGAAGGGAAGTGCGGGTGCGGG + Intergenic
1124139952 15:27068322-27068344 CTGCAGGAGCCTGCGGCTGGAGG + Intronic
1132885566 16:2180654-2180676 CTGCTGGTGCCTGCGGCTGCCGG - Exonic
1134406948 16:13969395-13969417 CTGGAGCTGCGTGGGGCTGCAGG - Intergenic
1139354137 16:66357269-66357291 CTGAAGGCGAGTGCAGCCTCGGG + Intergenic
1142426032 16:90002811-90002833 CTGAAGGCTCGTGTCCCTGCAGG - Intergenic
1143954054 17:10655161-10655183 CTGAGGGCTCCTGCGGCTGAAGG - Intronic
1144269310 17:13601566-13601588 GTGAGGGCACGCGCGGCTGCCGG + Exonic
1144311255 17:14016156-14016178 ATGAAGGCCCGTGTGGCTGGAGG - Intergenic
1144649800 17:17000180-17000202 CTGAAGGCTGGTGTGGCTGAGGG - Intergenic
1144874574 17:18390657-18390679 CTGCAGGCCTGTGTGGCTGCTGG + Intergenic
1144874823 17:18391920-18391942 CTGCAGGCCTGTGTGGCTGCTGG + Intergenic
1145157402 17:20552501-20552523 CTGCAGGCCTGTGTGGCTGCTGG - Intergenic
1145157655 17:20553764-20553786 CTGCAGGCCTGTGTGGCTGCTGG - Intergenic
1145759167 17:27416178-27416200 CTGCAGGCCTGTGTGGCTGCTGG + Intergenic
1145799816 17:27675849-27675871 CTGCAGGCCTGTGTGGCTGCTGG - Intergenic
1146159384 17:30551750-30551772 CTGCAGGCCTGTGCAGCTGCTGG + Intergenic
1146399223 17:32490190-32490212 TGGAAGGAGCCTGCGGCTGCTGG + Exonic
1146845178 17:36178040-36178062 CTGCAGGCCTGTGTGGCTGCTGG - Intronic
1146873399 17:36389889-36389911 CTGCAGGCCTGTGTGGCTGCTGG - Intronic
1146880753 17:36440971-36440993 CTGCAGGCCTGTGTGGCTGCTGG - Intergenic
1147065993 17:37922984-37923006 CTGCAGGCCTGTGTGGCTGCTGG + Intergenic
1147675742 17:42204079-42204101 GTGAAGGAGCGTGCAGGTGCTGG - Intronic
1149557751 17:57586261-57586283 TTGAAAGTGCCTGCGGCTGCAGG - Intronic
1149848329 17:60020554-60020576 CTGCAGGCCTGTGTGGCTGCTGG - Intergenic
1149861840 17:60125970-60125992 CTGCAGGCCTGTGTGGCTGCTGG + Intergenic
1150086678 17:62277121-62277143 CTGCAGGCCTGTGTGGCTGCTGG - Intronic
1151886178 17:76924479-76924501 CTGAGGCCGCGAGCTGCTGCAGG - Intronic
1152398602 17:80050294-80050316 CGGATGGCGTGTGGGGCTGCCGG - Intronic
1152876174 17:82787405-82787427 CTGAAGCCCTGGGCGGCTGCTGG + Intronic
1152931773 17:83113651-83113673 CTGAAAGCGTGTGAGGCTCCAGG - Intergenic
1154979685 18:21492438-21492460 CTAAATGCACGTGAGGCTGCTGG + Intronic
1157354126 18:46917581-46917603 CTGAAGGCGCGGGCGGAAGGCGG - Intronic
1158139621 18:54242373-54242395 CAGAAGGCTTGAGCGGCTGCAGG + Intergenic
1160039789 18:75335156-75335178 CTGCAGGAGCCTGGGGCTGCTGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161237352 19:3204551-3204573 CTAATGGCGCCTCCGGCTGCAGG + Exonic
1165124368 19:33583414-33583436 CTGAAGGCGTGTCCAGCTCCAGG + Intergenic
1167650962 19:50728393-50728415 CTGCAAGCCCGTGCGGCCGCTGG - Intergenic
1167749053 19:51368877-51368899 CTGAAAGGGCGTTCGGCTGTCGG - Exonic
925146399 2:1585871-1585893 CTGAGGGGGTGGGCGGCTGCGGG + Intergenic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
936163862 2:110103672-110103694 CTGAAGGAGCCACCGGCTGCTGG - Intronic
942541771 2:177022380-177022402 CTGAAAGCGCGTGAGGGTTCTGG - Intergenic
948099463 2:235361975-235361997 CTGAGGGCGTGTGCGGCTGAAGG - Intergenic
948481459 2:238253053-238253075 CTGCAGGGGCGAGCTGCTGCGGG + Exonic
1169546143 20:6652967-6652989 CTGAAGGCCAGTGTGGCTGAAGG - Intergenic
1175566483 20:59983065-59983087 CTGCAGGTGTGTGCGGCTGGGGG + Exonic
1180051055 21:45331133-45331155 CCGAAGGCCCGTGAGGCTCCTGG - Intergenic
1180620578 22:17159175-17159197 CGGGCGGCGCGCGCGGCTGCGGG - Exonic
954256473 3:49411428-49411450 CTGAAAGCGCGCGTGGCTGTCGG - Intronic
955920757 3:63953357-63953379 CAGAAGGCCCGTGTGGCTGAAGG + Intronic
956406367 3:68932489-68932511 CCGACTGCGCGCGCGGCTGCGGG - Exonic
956705033 3:71992305-71992327 CTGAATTCACCTGCGGCTGCAGG + Intergenic
963847005 3:150169745-150169767 CAGGAGGCGCGTGCAGCTACTGG - Intergenic
968467866 4:761922-761944 CAGAAGGCGCTGGCGGCTGTGGG + Intronic
975702152 4:77076319-77076341 CTGAGGGGGCGTGCGGTGGCCGG + Intergenic
980355524 4:131729505-131729527 CGGAAGGCGCGTCGGGATGCCGG + Intergenic
980992329 4:139748524-139748546 CTGAAGGAGCAGGAGGCTGCTGG + Intronic
985521010 5:373899-373921 GTGACGGCGCCGGCGGCTGCGGG + Intronic
1002204672 5:177554328-177554350 CTGGAGGCGGGAGCGGGTGCAGG - Exonic
1002665009 5:180816719-180816741 CGGAAGGCGCCTGGCGCTGCTGG + Intergenic
1005478768 6:26234722-26234744 AAGAAAGCGCTTGCGGCTGCTGG - Exonic
1007070203 6:39031272-39031294 CTGAATGCTCATGCGGCTTCAGG + Intergenic
1007752024 6:44076621-44076643 CGGACGGCGCGGGAGGCTGCCGG - Intergenic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019800500 7:3084767-3084789 CTGCAGGAGAGTCCGGCTGCTGG + Intergenic
1020016805 7:4836087-4836109 CTGAAGGCGCCTGGTGCTGAGGG + Intronic
1022090330 7:27103790-27103812 GAGCAGGCGCGTGCGGCTCCTGG + Intergenic
1029610027 7:101621949-101621971 CTGAAGGTGCGTGCACCTGGGGG + Intronic
1029896382 7:103989274-103989296 CTGAGGGCGCGCGCGGCGGCTGG - Exonic
1031886723 7:127252221-127252243 CTGACTGGGCGTGCGGCGGCAGG - Intronic
1031941344 7:127792808-127792830 CTGAACTCGCTTGCTGCTGCTGG + Intronic
1035752029 8:2002823-2002845 CTGCAGGCCCGTGGGGCCGCCGG - Exonic
1055069234 9:72149466-72149488 CTGCAGCTGCGGGCGGCTGCCGG - Exonic
1060477952 9:123999691-123999713 CTGCGGGCGCGTGCGGCCGGGGG - Intergenic
1062100952 9:134728307-134728329 CTGAAGGCCCGGGAGCCTGCTGG + Intronic
1062216027 9:135390321-135390343 CAGCAGGCCCATGCGGCTGCCGG - Intergenic
1062309258 9:135927160-135927182 CTGGAGGAGCCTGTGGCTGCAGG - Intergenic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1192952335 X:76029772-76029794 TTGAAGGTGGGGGCGGCTGCCGG + Intergenic