ID: 1019449326

View in Genome Browser
Species Human (GRCh38)
Location 7:1088669-1088691
Sequence TCTCACCAACCCTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019449317_1019449326 11 Left 1019449317 7:1088635-1088657 CCCACTCTGCCCTGCCCTGCGGT 0: 1
1: 1
2: 4
3: 56
4: 662
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data
1019449319_1019449326 2 Left 1019449319 7:1088644-1088666 CCCTGCCCTGCGGTGCCCCAGTC 0: 1
1: 0
2: 2
3: 35
4: 301
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data
1019449320_1019449326 1 Left 1019449320 7:1088645-1088667 CCTGCCCTGCGGTGCCCCAGTCA 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data
1019449321_1019449326 -3 Left 1019449321 7:1088649-1088671 CCCTGCGGTGCCCCAGTCACTCT 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data
1019449322_1019449326 -4 Left 1019449322 7:1088650-1088672 CCTGCGGTGCCCCAGTCACTCTC 0: 1
1: 0
2: 0
3: 20
4: 146
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data
1019449318_1019449326 10 Left 1019449318 7:1088636-1088658 CCACTCTGCCCTGCCCTGCGGTG 0: 1
1: 1
2: 6
3: 82
4: 584
Right 1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019449326 Original CRISPR TCTCACCAACCCTGAAGCCC TGG Intronic
No off target data available for this crispr