ID: 1019451008

View in Genome Browser
Species Human (GRCh38)
Location 7:1098022-1098044
Sequence GCGTCGTGAAGGATTTTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019451004_1019451008 -9 Left 1019451004 7:1098008-1098030 CCAGAAGGAAAAGAGCGTCGTGA 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1019451008 7:1098022-1098044 GCGTCGTGAAGGATTTTATGGGG 0: 1
1: 0
2: 0
3: 3
4: 36
1019451002_1019451008 8 Left 1019451002 7:1097991-1098013 CCTAGATGGGTGCTCTACCAGAA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1019451008 7:1098022-1098044 GCGTCGTGAAGGATTTTATGGGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019451008 Original CRISPR GCGTCGTGAAGGATTTTATG GGG Intronic
906141853 1:43538514-43538536 ACGTGGTGAAGGATTGAATGTGG + Intronic
916288866 1:163141356-163141378 ATGTCGTGAGGGATTATATGGGG + Intronic
917380602 1:174402085-174402107 GCTTCCTGAAGGATTTAATGGGG + Intronic
921134449 1:212247639-212247661 GCCTCCTGAGGGAGTTTATGTGG + Intergenic
924096894 1:240561345-240561367 AAGACGTGAAGGATTTTGTGTGG + Intronic
1083061624 11:59878804-59878826 ACGTCATGAAAGATTTTGTGAGG + Intergenic
1084856438 11:71990821-71990843 ACATCTTGAAGGATTTTATGTGG - Intronic
1096334275 12:50741417-50741439 GCGTCATGATGCATTGTATGTGG + Exonic
1138966919 16:62095564-62095586 GAGTCCTGTAGGATTTTCTGAGG + Intergenic
1140040595 16:71405016-71405038 GCGTCCTGAAGGCTTGTGTGAGG - Intergenic
1159331314 18:66997486-66997508 GCATCGAGAAAGATTTCATGAGG + Intergenic
1167043238 19:47035247-47035269 GCGTGGGGGAGGATTTAATGAGG + Intronic
939533961 2:143401372-143401394 GTTTAGTGAAAGATTTTATGGGG - Intronic
944617020 2:201471340-201471362 ACGTTGTGAAGGACTTCATGTGG + Intronic
1170404000 20:16017431-16017453 GTGTTGTGAAGGATATTTTGAGG + Intronic
1170650385 20:18234739-18234761 GCATCATGAAGGATTTTGAGCGG - Intergenic
1175641127 20:60631357-60631379 GCCACGTGAAGGATTTGAAGTGG - Intergenic
964743934 3:159994187-159994209 TCCTCTTGAAGGATTTTAAGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967552783 3:190818139-190818161 GCTTCTTGAAGGATTGTTTGAGG - Intergenic
968945773 4:3662874-3662896 GCGTCGTAAAGGATTTTCCAGGG - Intergenic
970661699 4:18292719-18292741 GAGTCATGAAGGGTTTTAAGTGG + Intergenic
971242439 4:24900748-24900770 GCATCATGGAGGATTTTAGGAGG + Intronic
982996616 4:162356623-162356645 GAGAAGTGATGGATTTTATGTGG + Intergenic
986844737 5:11739297-11739319 GCCTCCTGAAAGATTCTATGTGG + Intronic
1011383339 6:86766593-86766615 GAGTGGGGAAGGATTTGATGGGG + Intergenic
1014302208 6:119695770-119695792 GGGTCATGTAGGATATTATGTGG + Intergenic
1015134244 6:129849923-129849945 GTGTTGTCAAGGATTTTCTGGGG - Intronic
1019451008 7:1098022-1098044 GCGTCGTGAAGGATTTTATGGGG + Intronic
1020464826 7:8465461-8465483 GAGTTGGGAAGGATTGTATGTGG + Intronic
1020768344 7:12354368-12354390 ATGTCCAGAAGGATTTTATGGGG - Intronic
1029597721 7:101546573-101546595 GCCTGGGGAAGGGTTTTATGAGG + Intronic
1041167851 8:55108335-55108357 GAGTCATGAAGGATTATAGGGGG + Intronic
1041496978 8:58496267-58496289 GCGTCGTGAAGAACAGTATGGGG + Intronic
1047192231 8:122688637-122688659 GCGGGGTGAAGGATGTTATGGGG - Intergenic
1048363500 8:133718125-133718147 GGGCCATGAAGGATTTTAAGAGG + Intergenic
1057431574 9:94999559-94999581 ACATTGTGATGGATTTTATGGGG + Intronic
1061786103 9:133029676-133029698 GCCCCTTGAAGGGTTTTATGCGG - Intergenic
1196614288 X:117749988-117750010 GCTTCGGAAAGGATTTAATGTGG + Intergenic
1201666528 Y:16463169-16463191 ACGTCATGAAATATTTTATGTGG + Intergenic