ID: 1019451806

View in Genome Browser
Species Human (GRCh38)
Location 7:1102714-1102736
Sequence CGTGAGGGTGGGCCGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019451796_1019451806 6 Left 1019451796 7:1102685-1102707 CCACTGAACTGTGATCCTGCGCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1019451794_1019451806 23 Left 1019451794 7:1102668-1102690 CCTGGAGAACAGGTGACCCACTG 0: 1
1: 0
2: 2
3: 18
4: 167
Right 1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1019451799_1019451806 -9 Left 1019451799 7:1102700-1102722 CCTGCGCCCCTTTCCGTGAGGGT 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1019451795_1019451806 7 Left 1019451795 7:1102684-1102706 CCCACTGAACTGTGATCCTGCGC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019451806 Original CRISPR CGTGAGGGTGGGCCGCCCGC AGG Intronic
900109818 1:1000646-1000668 CCTGAGGGTGGGACCCCCGGAGG - Intergenic
900245498 1:1634351-1634373 CCTCGGGGTGGGCAGCCCGCGGG + Intronic
900256729 1:1701510-1701532 CCTCGGGGTGGGCAGCCCGCGGG + Intronic
901296811 1:8167202-8167224 CGTCAGGATGGACCGCCTGCTGG - Intergenic
901329100 1:8390840-8390862 CGTCAGGGAGGACCCCCCGCTGG - Intronic
906109187 1:43312093-43312115 CATGAGGGTGGGAGGCCCCCAGG - Exonic
909717543 1:78727932-78727954 CTTGAGGGTGGGGCCCTCGCTGG - Intergenic
910338049 1:86155828-86155850 CGTGAGGAAGGGTCGCCAGCGGG - Intronic
915537242 1:156544252-156544274 AGTGAGGGTGGGCCCCAAGCTGG - Intronic
918254820 1:182739746-182739768 CTTCTGGGTGGGCTGCCCGCTGG - Intergenic
921060434 1:211579628-211579650 CGTGGGGGCGGGCCGCGCGGCGG + Intergenic
1076404056 10:130200866-130200888 GGAGAGAGCGGGCCGCCCGCTGG + Intergenic
1079335102 11:19564240-19564262 CTTGAGGGTGGGGCGCTCTCTGG + Intronic
1081664238 11:44907173-44907195 CATGTGGGTGGGCCGCCAGCAGG - Intronic
1084396849 11:68916731-68916753 CGTGGGGATGGGCCGCCTGCTGG + Intronic
1084676167 11:70636030-70636052 GGTGAGGGTGGGCCGGGCACCGG - Intronic
1086437859 11:86800003-86800025 CGTGGGGGTGGGGCGCACACAGG + Intronic
1087845185 11:102964524-102964546 CTTGAGGGTGGGGCCCTCGCTGG - Intergenic
1091670654 12:2449869-2449891 GGTGAGGGTGGGGCGCACACAGG + Intronic
1095307109 12:40651492-40651514 CGTGAGGGTGGTCAGCCACCTGG + Intergenic
1096102058 12:48975816-48975838 CGTGAGGGTGGGAGGCTGGCTGG - Intergenic
1096271124 12:50167151-50167173 CGAGAGGATGTGCCGGCCGCGGG + Exonic
1100611520 12:96194858-96194880 CGCGCGGGAGGGCCGGCCGCGGG + Intronic
1105639686 13:22249674-22249696 CTTGAGGGTGGGGCTCTCGCTGG - Intergenic
1116720368 14:48488338-48488360 TGTTAGGGTGGGCCAACCGCTGG + Intergenic
1120229845 14:81829969-81829991 CGTGAGCGAGGGCTGCCAGCAGG + Intergenic
1122631706 14:103110234-103110256 CTCGAGGGGGGGCCGGCCGCTGG + Exonic
1125181846 15:36887557-36887579 CGGGAGGGTTGGCCGCCGGGTGG - Intergenic
1129328923 15:74816780-74816802 CGGCAGGGTGGGCCCCCTGCTGG - Intronic
1129691634 15:77717330-77717352 GGTGAGGGGGGGCAGCCCCCAGG + Intronic
1130547581 15:84868219-84868241 CTTGGGGGTGGGCCGCCTCCGGG - Exonic
1132552968 16:560815-560837 GGGGAGGGAGGGCCGCCCTCAGG + Intronic
1136893581 16:33983977-33983999 CGTGAGGGTGGTGGGCCTGCGGG + Intergenic
1139402843 16:66696291-66696313 CGTGCGGCTAGGCCGCCCTCGGG + Intronic
1141846066 16:86609895-86609917 CGTGAGGGTGGGGAGGACGCTGG + Intergenic
1141922174 16:87143642-87143664 CGTGATGGAGGGCGGCCTGCAGG - Intronic
1203079453 16_KI270728v1_random:1139645-1139667 CGTGAGGGTGGTGGGCCTGCGGG - Intergenic
1145912799 17:28552306-28552328 CGCGAGGGAGCGCCGCCCGCGGG - Intronic
1147571227 17:41572218-41572240 AGAGAGGCTGGGCCGCCCCCAGG - Intergenic
1147614831 17:41821707-41821729 CGGGAGGATGGGCTGCCCACAGG + Exonic
1147971559 17:44221038-44221060 GGTGAGGCTGAGCCGCCCGGAGG - Intronic
1148131760 17:45266553-45266575 GGTGTCGGTGGGCCGCCCCCGGG + Exonic
1149498253 17:57132573-57132595 GGTGAGGGTGGGCCGGCTGGAGG + Intergenic
1149498275 17:57132621-57132643 GGTGAGGGTGGGCCGGCTGGAGG + Intergenic
1149799632 17:59555310-59555332 CCTTAGGGTGGGCTGCCCGCAGG + Intergenic
1151508529 17:74544315-74544337 CGTGAGGGAGGGCCCACAGCGGG + Intronic
1159891276 18:73955447-73955469 CCTTAGGGTGGGCTGCCCACAGG - Intergenic
1160453117 18:78979069-78979091 GGAAAGGGTGGGCCGCGCGCGGG + Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162020142 19:7864574-7864596 AGTGAGGGGAGGCCGCTCGCTGG - Intronic
1162643948 19:12035358-12035380 AGTGGGGCTGGGCCGGCCGCCGG - Intronic
1162711321 19:12597016-12597038 CGTGGGGCTGGGCCGGCAGCTGG - Intronic
1163358352 19:16829586-16829608 GGTGAGGGGCGCCCGCCCGCGGG - Intronic
1163686337 19:18713990-18714012 GGTGAGCGTGGGCCGCCCACAGG - Intronic
1163696779 19:18768301-18768323 AGAGAGGGTGGGCCTCACGCAGG - Intronic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
931459345 2:62436824-62436846 CCTGAGGGTGGCCAGCCTGCAGG - Intergenic
934990298 2:98915650-98915672 AGAGAGGGTGGGCTGCCTGCTGG + Intronic
946366881 2:219253987-219254009 CTAGAGGCTGGGCGGCCCGCAGG + Exonic
947667231 2:231914037-231914059 CGTGGGGGAGGGCTGCCCTCAGG - Intergenic
949041565 2:241852136-241852158 CGGGAGTGAGGGCCGCCAGCAGG + Intronic
1169191445 20:3661096-3661118 GGTGAGCGCGGGCGGCCCGCGGG + Exonic
1169207447 20:3748385-3748407 CGTCAGGGTGAGCTGCCCCCGGG + Exonic
1175366783 20:58461309-58461331 GGTGAAGGTGGGCTGCCGGCAGG + Exonic
1178923075 21:36752196-36752218 CGTGAGGGAGGAGCGCCTGCTGG + Exonic
1184211709 22:43040010-43040032 CGCGAGGGTGGGGCCCCCTCAGG - Intronic
1184335305 22:43849323-43849345 CTTGAGGGTGGGACCCCTGCTGG - Intronic
1185288005 22:50010965-50010987 CGGGAGGCTGGGCCGCATGCAGG - Intronic
953246709 3:41199817-41199839 GGTGAGGGTGGGCCGCGCCCGGG + Intronic
953705199 3:45225745-45225767 CGTGCGCTGGGGCCGCCCGCGGG - Exonic
956277663 3:67520535-67520557 CGTGCTGGTGGGCAGCCCCCAGG - Exonic
961871068 3:129988608-129988630 CGTCAGGGAGGGCTGCCCGCAGG - Intergenic
964601213 3:158503351-158503373 TGTGAGGGTTGGCCTCCTGCTGG + Intronic
966834442 3:184038434-184038456 CCTGATGGTGGGCAGCCTGCTGG + Exonic
966843233 3:184106153-184106175 CCTGATGGTGGGCAGCCTGCTGG + Exonic
985828224 5:2208267-2208289 GGGGAGGGTGGGCTGCCCCCAGG + Intergenic
987314210 5:16709293-16709315 CCTGAGGGTGTGCCCCCCGCAGG - Intronic
1002901833 6:1416348-1416370 TGTGAGGCTGGGCCACCCACAGG + Intergenic
1008034918 6:46735349-46735371 CGGGCGGGTGGGCTGCGCGCGGG + Intronic
1019451806 7:1102714-1102736 CGTGAGGGTGGGCCGCCCGCAGG + Intronic
1022270102 7:28798591-28798613 CGGGAGGGTGGGCCTGCTGCCGG - Intronic
1027001572 7:74657996-74658018 GGCGAGTGTGGGCCGCGCGCGGG - Intronic
1029238705 7:99143697-99143719 GGCGCGGGTGGGCCTCCCGCCGG + Intronic
1035118881 7:156548354-156548376 CTTGAGGCTGGGCCGTCAGCTGG - Intergenic
1035382625 7:158449318-158449340 GGTGAGGGTGGTCGGCCCACAGG + Intronic
1035432170 7:158830057-158830079 GGTGAGAGGGCGCCGCCCGCCGG + Intronic
1035552983 8:544573-544595 GGCGAGGGTGGGCGGCGCGCAGG - Intronic
1048439546 8:134449998-134450020 CTTGAGGGTGGGGCCCTCGCTGG - Intergenic
1052824941 9:33167481-33167503 CGGGAGGGTGGGCAGCGGGCGGG + Intergenic
1057773433 9:97985372-97985394 CGCGAGGGTGGGCCGCTCCGGGG + Intronic
1060811930 9:126615031-126615053 GGTGAGGCTGGGGCGCTCGCTGG - Intronic
1061413508 9:130433326-130433348 CGTGTGTCTGTGCCGCCCGCAGG + Exonic
1061509561 9:131052324-131052346 GGTGTGGGTGGGCCCCCTGCAGG + Intronic
1061540324 9:131274899-131274921 CGCATGGGTGGGCTGCCCGCCGG + Intronic
1061666543 9:132163456-132163478 AGTGAGCGCGGGGCGCCCGCTGG + Intronic
1062577160 9:137214144-137214166 CGTGTGGGTGGGCGGCCCCTGGG + Intronic
1186021776 X:5264412-5264434 CCTTAGGGTGGGCCGCCTGCAGG - Intergenic
1189386260 X:40539355-40539377 CGTGTGGGTGGGGCGCCCCCAGG - Intergenic
1195722506 X:107879652-107879674 CTTGAGGGTGGGACGCTTGCCGG + Intronic
1196395957 X:115261788-115261810 CTTGAGGGTGGGGCCCTCGCTGG + Intergenic
1201315839 Y:12644385-12644407 CGTGATGGTTGGCCTCCTGCTGG - Intergenic