ID: 1019452154

View in Genome Browser
Species Human (GRCh38)
Location 7:1104668-1104690
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019452149_1019452154 27 Left 1019452149 7:1104618-1104640 CCAGGAGCGCAGCAAGTTTAAAC No data
Right 1019452154 7:1104668-1104690 GGAGACGTGAGCCGGGTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type