ID: 1019455686

View in Genome Browser
Species Human (GRCh38)
Location 7:1125952-1125974
Sequence TTTAACACTCAGAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019455683_1019455686 13 Left 1019455683 7:1125916-1125938 CCTAATGGTAAACACAGCTCAAT 0: 1
1: 0
2: 3
3: 13
4: 152
Right 1019455686 7:1125952-1125974 TTTAACACTCAGAACTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019455686 Original CRISPR TTTAACACTCAGAACTTGGT GGG Intronic
No off target data available for this crispr