ID: 1019471731

View in Genome Browser
Species Human (GRCh38)
Location 7:1224758-1224780
Sequence TGACCCCTCCACTCCGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019471724_1019471731 -9 Left 1019471724 7:1224744-1224766 CCTGCACCCCGCCCTGACCCCTC No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data
1019471721_1019471731 -3 Left 1019471721 7:1224738-1224760 CCCCGGCCTGCACCCCGCCCTGA No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data
1019471718_1019471731 27 Left 1019471718 7:1224708-1224730 CCGGCTTCTGCTGCGTGCGCGAG No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data
1019471720_1019471731 3 Left 1019471720 7:1224732-1224754 CCTGCACCCCGGCCTGCACCCCG No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data
1019471723_1019471731 -5 Left 1019471723 7:1224740-1224762 CCGGCCTGCACCCCGCCCTGACC No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data
1019471722_1019471731 -4 Left 1019471722 7:1224739-1224761 CCCGGCCTGCACCCCGCCCTGAC No data
Right 1019471731 7:1224758-1224780 TGACCCCTCCACTCCGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019471731 Original CRISPR TGACCCCTCCACTCCGTGCA GGG Intergenic
No off target data available for this crispr