ID: 1019472881

View in Genome Browser
Species Human (GRCh38)
Location 7:1230442-1230464
Sequence GAGAGCTCTTCAGAGGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019472881_1019472887 -10 Left 1019472881 7:1230442-1230464 CCGAGGGCCTCTGAAGAGCTCTC No data
Right 1019472887 7:1230455-1230477 AAGAGCTCTCGAGCCGGGCGGGG No data
1019472881_1019472893 22 Left 1019472881 7:1230442-1230464 CCGAGGGCCTCTGAAGAGCTCTC No data
Right 1019472893 7:1230487-1230509 GCCGCCCCCACCGTCATTAAAGG No data
1019472881_1019472888 -9 Left 1019472881 7:1230442-1230464 CCGAGGGCCTCTGAAGAGCTCTC No data
Right 1019472888 7:1230456-1230478 AGAGCTCTCGAGCCGGGCGGGGG No data
1019472881_1019472889 0 Left 1019472881 7:1230442-1230464 CCGAGGGCCTCTGAAGAGCTCTC No data
Right 1019472889 7:1230465-1230487 GAGCCGGGCGGGGGTCGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019472881 Original CRISPR GAGAGCTCTTCAGAGGCCCT CGG (reversed) Intergenic
No off target data available for this crispr