ID: 1019474253

View in Genome Browser
Species Human (GRCh38)
Location 7:1236442-1236464
Sequence GAAGTCCAGCCCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019474253_1019474263 20 Left 1019474253 7:1236442-1236464 CCGCCGCCGCGGGGCTGGACTTC 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1019474263 7:1236485-1236507 GCCGCGGACCCTGATCGGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 32
1019474253_1019474265 21 Left 1019474253 7:1236442-1236464 CCGCCGCCGCGGGGCTGGACTTC 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1019474265 7:1236486-1236508 CCGCGGACCCTGATCGGCAAGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1019474253_1019474262 15 Left 1019474253 7:1236442-1236464 CCGCCGCCGCGGGGCTGGACTTC 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1019474262 7:1236480-1236502 TGCGCGCCGCGGACCCTGATCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1019474253_1019474260 4 Left 1019474253 7:1236442-1236464 CCGCCGCCGCGGGGCTGGACTTC 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1019474260 7:1236469-1236491 CCGGGCTGCCGTGCGCGCCGCGG 0: 1
1: 0
2: 2
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019474253 Original CRISPR GAAGTCCAGCCCCGCGGCGG CGG (reversed) Exonic
900113547 1:1019599-1019621 GGTGTCCGGCCCCGCGGGGGAGG + Intergenic
900148437 1:1168158-1168180 GAAGTCCAGCCCCCAGGGGAGGG + Intergenic
900783588 1:4633628-4633650 GAAGTGCAGGCCCCCGGCGCGGG - Intergenic
900799172 1:4727005-4727027 GGAGCCCAGCCCCCCGGCGTGGG + Intronic
901014077 1:6217783-6217805 GCTGTCCAGCCCCGCGGTGATGG - Intronic
902839328 1:19065316-19065338 GCAGTCCAACCCTGCGGCTGGGG + Intergenic
903380748 1:22895520-22895542 GAAGACCAGGCCAGCGGCCGAGG - Exonic
904181305 1:28668731-28668753 GAAGCCCGGCCTGGCGGCGGCGG + Intronic
904252146 1:29232717-29232739 AAAGTCCAGCCCCAAGGAGGAGG - Intergenic
905028254 1:34865701-34865723 GAAGCCCAGCCCCGCGGGGTGGG + Exonic
905066863 1:35192140-35192162 GAAGCCCAGCGCGGGGGCGGGGG + Intronic
905742908 1:40388041-40388063 GAAATCCAGCGCAGCGCCGGTGG - Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
908523397 1:64966134-64966156 GATTTCCAGCCCCGCGGAGCCGG - Intronic
910787996 1:91021655-91021677 CGAGTCCCGCCCCGCGGCGGCGG + Intronic
915128093 1:153679524-153679546 GAAGCCCAGCGCCGGGGCGCCGG - Exonic
921903820 1:220475841-220475863 GAAATCGAGCACAGCGGCGGTGG + Intergenic
922753734 1:228082863-228082885 CACGTCGACCCCCGCGGCGGCGG + Intronic
1069999321 10:72364573-72364595 GGAGTCAAGCCCCGTGGCGAGGG - Intergenic
1070292655 10:75129523-75129545 GAAGTCCAGGCCGGGTGCGGTGG - Intronic
1073301118 10:102471419-102471441 GAAGTCCAGCCCAGCTGTAGAGG - Intronic
1078729547 11:13962969-13962991 GAAGGCCAGCGCCGCGGCCAGGG - Exonic
1081315263 11:41623213-41623235 GAAGTGCAGGCCCACGGCGTGGG + Intergenic
1083485587 11:62981332-62981354 GAGGTCCAGCCTCCCGGAGGAGG + Exonic
1087683793 11:101241421-101241443 GAAGTCAAGCACAGCGCCGGTGG + Intergenic
1090327895 11:125904604-125904626 GAGCTCCACCCCCGCGGCTGTGG - Intronic
1096102669 12:48979022-48979044 CAACTCCAGCCTCACGGCGGTGG + Intronic
1101021640 12:100559570-100559592 GAAATCCAGCGCAGCGCCGGTGG - Intronic
1103595521 12:122022473-122022495 GGAGCCGAGCGCCGCGGCGGGGG - Intronic
1105000680 12:132687924-132687946 GAAGTTCAGCGCCGGGTCGGAGG - Intronic
1105202733 13:18194120-18194142 GAAGCGCTGCCCCGAGGCGGTGG + Intergenic
1109441383 13:62379416-62379438 GAAATCGAGCCCAGCGCCGGTGG - Intergenic
1109854282 13:68107889-68107911 GAATTCCAGCGCAGCGCCGGCGG + Intergenic
1110751384 13:79119807-79119829 GAAATCCAGCACAGCGCCGGTGG + Intergenic
1113925649 13:113940106-113940128 AAAGTCCACCCCAGGGGCGGGGG + Intergenic
1114628106 14:24142409-24142431 GGAGTCCAGGCCCGGCGCGGTGG + Intergenic
1119038857 14:71254485-71254507 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
1119476706 14:74934699-74934721 GAATTCCAGCCTCTCGGAGGAGG - Intergenic
1122548597 14:102538390-102538412 GAAGGCCAGGCCCGCTGTGGGGG - Intergenic
1122787891 14:104172311-104172333 GAAGTCCAGCCGCCGGGCGCAGG - Intronic
1122807059 14:104265016-104265038 GCAGTGCAGCCCCGGGGTGGGGG + Intergenic
1123037997 14:105479084-105479106 GAGGCCGAGCCCCGGGGCGGGGG - Intronic
1202858418 14_GL000225v1_random:65168-65190 GATGTCCAGGCCTGCGGCCGGGG + Intergenic
1123701416 15:22917263-22917285 GAAGACCAGCCCCAGGACGGAGG + Intronic
1125999309 15:44194731-44194753 GGAGACTCGCCCCGCGGCGGCGG + Intronic
1127964579 15:63914209-63914231 GATGTACAGCTCCGGGGCGGGGG + Intronic
1128109621 15:65068138-65068160 GAGGCCCAGCCCGGCGGTGGGGG - Intronic
1128141041 15:65301243-65301265 GAAATCCAGCACAGCGCCGGTGG + Intergenic
1128664789 15:69530231-69530253 GAATTTCAGCCCCGAGGAGGTGG + Intergenic
1132870410 16:2113271-2113293 GAGGTACAGCCCCGTGGTGGAGG - Exonic
1133784416 16:8963577-8963599 GGAGGCGGGCCCCGCGGCGGCGG - Intronic
1134522130 16:14923654-14923676 GAGGTACAGCCCCGTGGTGGAGG + Intronic
1134709799 16:16322305-16322327 GAGGTACAGCCCCGTGGTGGAGG + Intergenic
1134717013 16:16362335-16362357 GAGGTACAGCCCCGTGGTGGAGG + Intergenic
1134738990 16:16525472-16525494 GAATTCCAGGCCCGGCGCGGTGG - Intergenic
1134928511 16:18186680-18186702 GAATTCCAGGCCCGGCGCGGTGG + Intergenic
1134949804 16:18346340-18346362 GAGGTACAGCCCCGTGGTGGAGG - Intergenic
1134957738 16:18389824-18389846 GAGGTACAGCCCCGTGGTGGAGG - Intergenic
1136382419 16:29901677-29901699 GGGGACCAGCCCCGAGGCGGAGG - Exonic
1136451802 16:30357921-30357943 GCAGTCCAGCCCCAGGGCAGAGG + Exonic
1141456274 16:84144767-84144789 GGGGTGCAGCGCCGCGGCGGGGG + Intronic
1141813870 16:86396007-86396029 GATGTCCAGTCCCACGGCAGAGG - Intergenic
1142757577 17:2025029-2025051 GAGCTCCAGCCCCGCGCCGAGGG + Exonic
1144625805 17:16843952-16843974 GAATTCCAGCCCCGGGGCCTTGG + Intergenic
1144880627 17:18428768-18428790 GAATTCCAGCCCCGGGGCCTTGG - Intergenic
1145151609 17:20515619-20515641 GAATTCCAGCCCCGGGGCCTTGG + Intergenic
1146162963 17:30569877-30569899 GAATTCCAGCCCCGGGGCCCCGG + Intergenic
1147719808 17:42532131-42532153 GACGCCCGGCCCGGCGGCGGCGG - Intergenic
1148493358 17:48037453-48037475 GAACTTCAGCCCCGCGCCGACGG + Intronic
1148664116 17:49361953-49361975 GCGGTCCATCCCTGCGGCGGGGG + Intronic
1149916398 17:60613803-60613825 GAAATCCAGCGCAGCGCCGGTGG - Intronic
1151649356 17:75456730-75456752 GAAGACCAGCCCCGGGGCCCCGG + Exonic
1152718369 17:81910817-81910839 GCATTCTAGCCCCGCGGAGGAGG + Intronic
1157594368 18:48855006-48855028 GAAATGCAGCTCCGGGGCGGTGG - Intronic
1157608694 18:48942375-48942397 GAAGTCCAGACCAGCTGGGGTGG + Intronic
1160500334 18:79398519-79398541 GAAGCCCAGCACTGGGGCGGGGG + Intronic
1160506490 18:79429841-79429863 GCAGTCCTGCACCGCGGCGTCGG + Intronic
1160518892 18:79493410-79493432 GCAGACCAGCCCCGCGCCGAGGG - Intronic
1160895825 19:1401413-1401435 GAACTGCAGCCCCGCGTGGGGGG - Exonic
1166388085 19:42393135-42393157 GAAGGCCAGCCCAGCGGGGCTGG + Intergenic
1167233062 19:48297447-48297469 GCCGTCCAGCTTCGCGGCGGCGG + Exonic
925601524 2:5612934-5612956 GAAGCCCAGCCCAGCTGCAGAGG + Intergenic
927714174 2:25341776-25341798 GAAGGCCGGCCCGGAGGCGGCGG - Intronic
928313759 2:30231206-30231228 GAACTCCAGCGCGGCGGAGGTGG - Intergenic
928511775 2:32010094-32010116 GCGGCCCGGCCCCGCGGCGGCGG - Intronic
933487242 2:82938617-82938639 GAAATCCAGCGCAGCGCCGGTGG + Intergenic
935059356 2:99593998-99594020 GAAGTCCCCGCCCGCGGCCGTGG - Exonic
935675711 2:105593704-105593726 GAAGTCCAGCCCAGCAGCAGAGG + Intergenic
936526761 2:113246705-113246727 GAAGTCAAGCCCTGCGGGGAAGG + Intronic
937906454 2:127055095-127055117 GAACTCCAGCCCCGCAGCCCAGG + Intronic
938261838 2:129902277-129902299 GAAGTGCAGCCCAGCATCGGTGG + Intergenic
939434548 2:142157023-142157045 GAAGTCAAGCCCCTGGGTGGGGG + Intergenic
946008925 2:216549192-216549214 GCAGGCCAGCCCCATGGCGGGGG - Intronic
948028721 2:234799394-234799416 GAAGTCCAGCCCTGGCACGGAGG - Intergenic
948467438 2:238159072-238159094 GGACCCCAGGCCCGCGGCGGCGG - Exonic
1171973415 20:31578734-31578756 GAAATCCAGCGCAGCGCCGGTGG + Intergenic
1172978965 20:38926842-38926864 CACTTCCAGCCCCGCGGCGCTGG + Exonic
1173656399 20:44703093-44703115 GAAGCCCAGCCAGGCGGAGGGGG - Intergenic
1174454660 20:50640631-50640653 GCTGTCCAGCCCTGCGGAGGGGG - Intronic
1174472140 20:50769091-50769113 GCTGTCCAGCCCTGCGGAGGGGG + Intergenic
1176715220 21:10343885-10343907 GAAGCGCTGCCCCGAGGCGGTGG - Intergenic
1178398755 21:32265520-32265542 GAAATCCAGCACAGCGCCGGTGG - Intergenic
1178433987 21:32541263-32541285 GAAGTCCAGGCCGGGCGCGGTGG + Intergenic
1180603128 22:17036070-17036092 GAAGCGCTGCCCCGAGGCGGTGG + Intergenic
1183395430 22:37568544-37568566 GAAGTCCAGCCCAGTGGGAGGGG + Exonic
949548920 3:5096287-5096309 GAACTCCAGCCCAGCTTCGGAGG - Intergenic
951951075 3:28200584-28200606 GAAGTCGAGCGCAGCGCCGGTGG + Intergenic
954755270 3:52835805-52835827 GCAGGCCAGCCCCCCTGCGGTGG - Intronic
960669217 3:120140438-120140460 GAATTCCAGCGCAGCGCCGGCGG - Intergenic
961494905 3:127284428-127284450 GAAGCCCAGCCCCACTGCCGCGG + Intergenic
961821337 3:129577216-129577238 GAAGTCAGGCCCAGCGGTGGGGG - Intronic
965298144 3:166976023-166976045 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
966725419 3:183103917-183103939 GAAATCCAGCGCAGCGCCGGTGG + Intronic
968508931 4:986975-986997 AAGGCCCCGCCCCGCGGCGGCGG + Exonic
968660260 4:1795851-1795873 AAAGTCCAGCCCTGCAGAGGAGG - Intronic
968969032 4:3783974-3783996 CAAGCACAGCCCCGGGGCGGGGG + Intergenic
969494982 4:7521345-7521367 GAAGTGCAGCCCGGTGCCGGAGG - Intronic
971564183 4:28117312-28117334 GAATTCCAGCGCAGCGCCGGCGG + Intergenic
971907682 4:32748360-32748382 AGAGTCCAGCCCCTGGGCGGCGG + Intergenic
973236721 4:47914103-47914125 GGAGTCCATCTCCGCGGCGCCGG - Exonic
976690592 4:87863839-87863861 GAATTCCAGCGCAGCGCCGGGGG + Intergenic
979547274 4:121951972-121951994 GCTCTCCAGCCCCGCGGCGGCGG + Intergenic
979991476 4:127380124-127380146 GAAATCCAGCACAGCGCCGGTGG - Intergenic
982408242 4:155044492-155044514 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
984921464 4:184767815-184767837 GAACACCAGCCCCTCTGCGGTGG - Intronic
985964045 5:3326205-3326227 GGAGTCCACCCGCGCCGCGGCGG + Intergenic
986369501 5:7065849-7065871 GAAGACCAGCCCCACAGCAGTGG - Intergenic
988483886 5:31652278-31652300 CAAGTCCAGACCCAGGGCGGTGG - Intronic
993105880 5:83600352-83600374 GCACTCCAGCCCGGCGGCAGAGG - Intergenic
994701684 5:103142205-103142227 GAAATCCAGCGCAGCGCCGGTGG + Intronic
996298540 5:121954109-121954131 GAATTCCAGCGCCGCGCGGGTGG + Intergenic
997666274 5:135631930-135631952 GAAGTCCAACCCAGGGGAGGGGG + Intergenic
999326934 5:150649589-150649611 CAGGGCCAGCCCCGCGGCGGCGG + Exonic
999748715 5:154610651-154610673 GAAGGTCCGGCCCGCGGCGGCGG - Intergenic
1000079677 5:157833061-157833083 GAAGTCCAGGCCAGGCGCGGTGG + Intronic
1002523623 5:179804362-179804384 GAAGTCCAGGCCTGGGGAGGCGG + Intronic
1003736911 6:8887356-8887378 GAAATCGAGCCCAGCGCCGGTGG - Intergenic
1006115870 6:31775975-31775997 GAAGTGCAGCCCCGAGGCGCTGG + Exonic
1007280059 6:40705425-40705447 GAAGTTCAGCCCAGCTGCAGAGG - Intergenic
1010199296 6:73269044-73269066 GAAATCGAGCCCAGCGCCGGTGG + Intronic
1010235634 6:73572706-73572728 GAAATCGAGCCCAGCGCCGGTGG + Intergenic
1017018147 6:150117584-150117606 GAAGCACAGCCTCGTGGCGGGGG + Intergenic
1018745410 6:166757867-166757889 GAAGGCCAGCCTCGGGGCTGAGG - Intronic
1018975872 6:168565306-168565328 GAAGTCCAGGCCCGAGGTGCTGG + Intronic
1019474253 7:1236442-1236464 GAAGTCCAGCCCCGCGGCGGCGG - Exonic
1021686753 7:23193904-23193926 GAAATCCAGCGCAGCGCCGGTGG + Intronic
1027263375 7:76480545-76480567 GTACACCAGCCCCGCGGCTGTGG + Exonic
1033186560 7:139231803-139231825 GAAGCCGACTCCCGCGGCGGGGG - Exonic
1034422599 7:150997251-150997273 GAAGTCTAGACCTGCTGCGGGGG + Intronic
1034422605 7:150997278-150997300 GAAGTCTAGACCTGCTGCGGGGG + Intronic
1035999253 8:4583017-4583039 GAAGTCGAGCACAGCGCCGGTGG - Intronic
1037262926 8:17027601-17027623 GAGGACCCGCCCCGCGGCCGGGG + Exonic
1037836305 8:22216642-22216664 TAAATCCAGCCCAGCGGGGGCGG + Intergenic
1041369462 8:57143466-57143488 GAGTCCCAGCCCCGCTGCGGCGG - Intergenic
1049194599 8:141308394-141308416 GAATCCCCGTCCCGCGGCGGCGG - Intergenic
1049643630 8:143726601-143726623 GAAGGCCGGGCCCGCGGAGGAGG - Exonic
1054722462 9:68617213-68617235 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
1054775796 9:69122338-69122360 GTTTTCAAGCCCCGCGGCGGAGG - Intronic
1055937495 9:81616545-81616567 GAAGTAGAGCCCCTCGGTGGGGG - Intronic
1057503003 9:95610742-95610764 GAAGTCCTGCCCCGGCCCGGTGG + Intergenic
1061482307 9:130903211-130903233 GCAGTCCAGCCCCACGGTGCAGG + Exonic
1061967885 9:134026152-134026174 GAAGTCAAGCGCCCCGGCAGCGG - Intergenic
1062626015 9:137441746-137441768 AAGGTCCAGGCCCGGGGCGGGGG + Intronic
1196582705 X:117394870-117394892 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
1196827262 X:119750993-119751015 GAAATCCAGCACAGCGCCGGTGG + Intergenic
1196845072 X:119890780-119890802 GAAATCCAGCGCAGCGCCGGTGG - Intergenic
1199991434 X:152989746-152989768 GAAGTGAAGCCCCGCAGGGGAGG - Exonic
1200224761 X:154411452-154411474 CGAGGCCAGCCCCGGGGCGGCGG - Intronic
1201496926 Y:14598368-14598390 GAAATCCAGCGCAGCGCCGGTGG + Intronic