ID: 1019474539

View in Genome Browser
Species Human (GRCh38)
Location 7:1237581-1237603
Sequence CCGCGCGCCCCCGCGCGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019474524_1019474539 30 Left 1019474524 7:1237528-1237550 CCGCCCCGGCGCTCCCCCTCCTA No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474534_1019474539 6 Left 1019474534 7:1237552-1237574 CCCGCGCCGCACACGCACGCTCA No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474527_1019474539 25 Left 1019474527 7:1237533-1237555 CCGGCGCTCCCCCTCCTACCCCG No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474536_1019474539 0 Left 1019474536 7:1237558-1237580 CCGCACACGCACGCTCACATCCG No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474533_1019474539 7 Left 1019474533 7:1237551-1237573 CCCCGCGCCGCACACGCACGCTC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474531_1019474539 14 Left 1019474531 7:1237544-1237566 CCTCCTACCCCGCGCCGCACACG No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474525_1019474539 27 Left 1019474525 7:1237531-1237553 CCCCGGCGCTCCCCCTCCTACCC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474526_1019474539 26 Left 1019474526 7:1237532-1237554 CCCGGCGCTCCCCCTCCTACCCC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474535_1019474539 5 Left 1019474535 7:1237553-1237575 CCGCGCCGCACACGCACGCTCAC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474532_1019474539 11 Left 1019474532 7:1237547-1237569 CCTACCCCGCGCCGCACACGCAC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474529_1019474539 16 Left 1019474529 7:1237542-1237564 CCCCTCCTACCCCGCGCCGCACA No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474528_1019474539 17 Left 1019474528 7:1237541-1237563 CCCCCTCCTACCCCGCGCCGCAC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data
1019474530_1019474539 15 Left 1019474530 7:1237543-1237565 CCCTCCTACCCCGCGCCGCACAC No data
Right 1019474539 7:1237581-1237603 CCGCGCGCCCCCGCGCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019474539 Original CRISPR CCGCGCGCCCCCGCGCGCAC TGG Intergenic
No off target data available for this crispr