ID: 1019474754

View in Genome Browser
Species Human (GRCh38)
Location 7:1238727-1238749
Sequence CAGTGGAAGCCAGGAGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019474745_1019474754 1 Left 1019474745 7:1238703-1238725 CCCAACTCTGGGACAGGCCGCCC No data
Right 1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG No data
1019474739_1019474754 30 Left 1019474739 7:1238674-1238696 CCACGGGAAGGAGACCTCTGCGC No data
Right 1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG No data
1019474746_1019474754 0 Left 1019474746 7:1238704-1238726 CCAACTCTGGGACAGGCCGCCCC No data
Right 1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG No data
1019474741_1019474754 16 Left 1019474741 7:1238688-1238710 CCTCTGCGCTGGTTGCCCAACTC No data
Right 1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019474754 Original CRISPR CAGTGGAAGCCAGGAGTTGT CGG Intergenic
No off target data available for this crispr