ID: 1019475361

View in Genome Browser
Species Human (GRCh38)
Location 7:1241633-1241655
Sequence CCCGCGCGGGGGGTTCCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475361_1019475373 2 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475361_1019475380 18 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475380 7:1241674-1241696 GAGCTGGCGTGAGTATGGAGGGG No data
1019475361_1019475377 13 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475361_1019475381 19 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475361_1019475371 -8 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475371 7:1241648-1241670 CGCGCGGGGAACCACCGGGCCGG No data
1019475361_1019475378 16 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475378 7:1241672-1241694 CAGAGCTGGCGTGAGTATGGAGG No data
1019475361_1019475382 26 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475382 7:1241682-1241704 GTGAGTATGGAGGGGGCGCGTGG No data
1019475361_1019475383 27 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475383 7:1241683-1241705 TGAGTATGGAGGGGGCGCGTGGG No data
1019475361_1019475379 17 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475379 7:1241673-1241695 AGAGCTGGCGTGAGTATGGAGGG No data
1019475361_1019475384 28 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475384 7:1241684-1241706 GAGTATGGAGGGGGCGCGTGGGG No data
1019475361_1019475372 -7 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475361 Original CRISPR CCCGCGCGGGGGGTTCCGTC CGG (reversed) Intergenic
No off target data available for this crispr